ID: 916808162

View in Genome Browser
Species Human (GRCh38)
Location 1:168280408-168280430
Sequence GAGCCCTGACCCTTGAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916808159_916808162 16 Left 916808159 1:168280369-168280391 CCTGGGAGAAAGAGATTCTGAGC 0: 1
1: 0
2: 2
3: 28
4: 295
Right 916808162 1:168280408-168280430 GAGCCCTGACCCTTGAGCAGTGG 0: 1
1: 0
2: 0
3: 18
4: 199
916808158_916808162 17 Left 916808158 1:168280368-168280390 CCCTGGGAGAAAGAGATTCTGAG 0: 1
1: 0
2: 5
3: 22
4: 306
Right 916808162 1:168280408-168280430 GAGCCCTGACCCTTGAGCAGTGG 0: 1
1: 0
2: 0
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916808162 Original CRISPR GAGCCCTGACCCTTGAGCAG TGG Intergenic
900504837 1:3024733-3024755 GAGACCTGACCCATGACCTGGGG - Intergenic
900638981 1:3679304-3679326 GAGCCCTGAGCCCTGCGCGGAGG + Intronic
901208098 1:7508790-7508812 CAGCCCTGGCCCTGGAGGAGAGG + Intronic
902209210 1:14892673-14892695 GAACCCTGAGCCATGGGCAGGGG - Intronic
903300796 1:22377248-22377270 GAGGCCTCTTCCTTGAGCAGAGG + Intergenic
906132594 1:43469398-43469420 GAGCCCTGCCCCTTCTGCATTGG - Intergenic
906534922 1:46546107-46546129 GATCCCTGCCACTTGTGCAGAGG + Intronic
910810942 1:91235730-91235752 GAGACGTGACCATGGAGCAGAGG - Intergenic
912201384 1:107461855-107461877 GTTCCCTGGGCCTTGAGCAGAGG + Intronic
914464618 1:147915559-147915581 AAAACCTGACCCTTGACCAGGGG - Intergenic
916513930 1:165497832-165497854 GGGTGGTGACCCTTGAGCAGAGG + Intergenic
916666273 1:166970575-166970597 GAGCCCTGACCTGGGAGCTGAGG - Intronic
916808162 1:168280408-168280430 GAGCCCTGACCCTTGAGCAGTGG + Intergenic
924772719 1:247090477-247090499 GGGCCCTGATCTTTGAGAAGGGG + Intergenic
1063477137 10:6339310-6339332 GAGCTTTGAGCCTTGAGCTGTGG + Intergenic
1064122748 10:12633901-12633923 ATGCCCTGACCCTTTTGCAGTGG + Intronic
1065708013 10:28488979-28489001 GACCTCTCACGCTTGAGCAGGGG - Intergenic
1067936363 10:50615545-50615567 GAGCCCTGACCCTGGACCCTGGG - Intronic
1068634748 10:59336446-59336468 GAGATCTGAGCCGTGAGCAGTGG - Intronic
1068733478 10:60386082-60386104 GGGCCCTGGTCCATGAGCAGTGG - Intronic
1069954248 10:72040205-72040227 GAGCCCTGACCCTACGGCGGGGG - Intergenic
1070564467 10:77593084-77593106 GCGCCCAGAACCTTGAGCAGTGG + Intronic
1075815975 10:125265198-125265220 GAGCCCGGTCCCTGGAGAAGAGG + Intergenic
1076523952 10:131099091-131099113 GAGGCCTGACCCTCGGGCACTGG + Intronic
1076889943 10:133278494-133278516 AAGCCCTGGGCCTTGAGAAGTGG - Intergenic
1077105063 11:838588-838610 GAGCTCTGACCCTTGGGCCTGGG + Exonic
1077116072 11:885172-885194 GCCCAGTGACCCTTGAGCAGAGG - Intronic
1077278945 11:1733293-1733315 GAGCACTGACCCTTGAACCCAGG - Exonic
1077390377 11:2298265-2298287 GGGCCCTGACGCTTGAGCATCGG + Intronic
1078307580 11:10205631-10205653 AAGCCCAGAACCATGAGCAGGGG + Intronic
1079280083 11:19079466-19079488 GAGGATGGACCCTTGAGCAGTGG + Intergenic
1080328447 11:31107192-31107214 GAGCTCTGACCCTTTGGCACGGG + Intronic
1080646647 11:34192719-34192741 GAAGCCAGACCCTTGAGGAGTGG - Intronic
1084522159 11:69670230-69670252 CAGCCCTTACCCCAGAGCAGGGG - Intronic
1084890537 11:72234634-72234656 GTGCCCTCACCCATAAGCAGGGG - Intronic
1085758693 11:79223472-79223494 TAGCACTGACCTCTGAGCAGAGG - Intronic
1087159723 11:94936759-94936781 GTGCCCTGACCCTACTGCAGTGG - Intergenic
1087176335 11:95099466-95099488 GAGCTCCGCTCCTTGAGCAGAGG + Intronic
1087387771 11:97494098-97494120 GATCACTGAACCTTGAGAAGTGG + Intergenic
1088364181 11:109021482-109021504 GGGCACTAACCCTTGAACAGTGG + Intergenic
1088919506 11:114251001-114251023 CAGCCCAGACCCATCAGCAGGGG - Intergenic
1089216514 11:116837548-116837570 AAGGCCTGAACCTTGAGCTGGGG + Intronic
1089304437 11:117517714-117517736 GACCCCTGACCCAAGGGCAGAGG - Intronic
1091344208 11:134842115-134842137 GAGCCCTGCCCCAGGTGCAGGGG - Intergenic
1091389845 12:119429-119451 GAGCCCTGAGCCCTTAGCAAAGG + Intronic
1092157799 12:6295682-6295704 GAGTCCTGACCTTTAAGCCGAGG - Intergenic
1093710840 12:22328155-22328177 GAGCTCTTACTCTAGAGCAGAGG - Intronic
1096527035 12:52216244-52216266 CACCTCTGACTCTTGAGCAGGGG + Intergenic
1096760016 12:53833600-53833622 GAGGCCTGACCCTAGACCAGGGG + Intergenic
1102438510 12:112944014-112944036 AAGCCCTGATCCTTTAGCAGTGG - Intronic
1102624635 12:114225188-114225210 GACCCCTGACCCCAGATCAGTGG - Intergenic
1104853984 12:131893815-131893837 GAGAACTCACCCTTGAGCACAGG + Intergenic
1104967318 12:132514116-132514138 GAGCCCTGACGCGAGAACAGAGG - Intronic
1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG + Intronic
1108139410 13:47403256-47403278 GAGCCTTGAATATTGAGCAGAGG + Intergenic
1111028514 13:82567012-82567034 CAGCCCTGACCCTGCTGCAGAGG + Intergenic
1112407329 13:99132733-99132755 CATCCCTGACCTTTGACCAGTGG - Intergenic
1112562621 13:100527436-100527458 AATCCCTGACCCTGGAGAAGTGG - Intronic
1113041115 13:106104663-106104685 GAGCCGTGTCCCATGGGCAGAGG - Intergenic
1115709114 14:36030472-36030494 GATCTCTGACTCTTGAGCACAGG - Intergenic
1119197970 14:72731699-72731721 GAGCCCCGGCCCTTGAGGGGAGG + Intronic
1120957990 14:90099793-90099815 GGACCCTCCCCCTTGAGCAGAGG - Intronic
1122346195 14:101062038-101062060 GATGTTTGACCCTTGAGCAGAGG + Intergenic
1122826842 14:104374689-104374711 GAGCCCTGGCCCAGGAGGAGAGG + Intergenic
1122920364 14:104877464-104877486 GAGGCCTGACCCTTGGCCAAGGG + Intronic
1123122069 14:105921376-105921398 GAGCCCTGACAATAGAGCACTGG + Intronic
1123178413 14:106443657-106443679 CAGCCCTGACCCTGCAGCTGTGG - Intergenic
1123212693 14:106775691-106775713 CAGCCCTGACCCTGCAGCACTGG - Intergenic
1123404756 15:20013025-20013047 GAGCCCTGACAATAGAGCACTGG + Intergenic
1123514087 15:21019672-21019694 GAGCCCTGACAATAGAGCACTGG + Intergenic
1128642215 15:69348027-69348049 GACCCCTGCCCTTTGAGCTGAGG - Intronic
1128924218 15:71639432-71639454 GAACCCAGACCCTTGTGGAGTGG - Intronic
1129723358 15:77889679-77889701 GGGGCCTGACCCTGGGGCAGTGG + Intergenic
1132734516 16:1378962-1378984 AAGAGCTGACCCTTGTGCAGAGG + Intronic
1132935191 16:2476290-2476312 GAGCCCTGGCCCTCGGGCGGAGG - Intronic
1134862189 16:17570218-17570240 GATCCCTGATTCTTGATCAGAGG - Intergenic
1136083343 16:27867478-27867500 GAGCGCTGCCCCATGAGCTGTGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136680940 16:31961840-31961862 CAGCCCTGACCCTGCAGCCGTGG + Intergenic
1136781259 16:32903353-32903375 CAGCCCTGACCCTGCAGCCGTGG + Intergenic
1136888539 16:33950487-33950509 CAGCCCTGACCCTGCAGCCGTGG - Intergenic
1137801666 16:51267133-51267155 CAGCCCTGAAGCTGGAGCAGGGG + Intergenic
1140028173 16:71311099-71311121 GAGCCCTGATCCAGGAGCACTGG + Intergenic
1141511070 16:84512498-84512520 GGGCCCTGAACCTTGAACACTGG - Intronic
1141647773 16:85376685-85376707 GTGCCCTCACCCTTCAGCACAGG + Intergenic
1142124859 16:88405234-88405256 GAGCCCTGAGCCTTGGGGTGTGG + Intergenic
1142221859 16:88859101-88859123 GAGCCACCACCTTTGAGCAGGGG + Intronic
1203083915 16_KI270728v1_random:1167335-1167357 CAGCCCTGACCCTGCAGCCGTGG + Intergenic
1143089326 17:4439732-4439754 GAGCCCTGGCTCTGGAGCCGGGG + Intronic
1143562908 17:7705743-7705765 GATCCCAGACCCTAGGGCAGTGG + Intronic
1144622932 17:16830030-16830052 GAGCCCTGCTCCTTGAGGATGGG + Intergenic
1144784782 17:17825447-17825469 GAGGGCTGGCCCTTGGGCAGAGG + Intronic
1144883498 17:18442686-18442708 GAGCCCTGCTCCTTGAGGATGGG - Intergenic
1145148730 17:20501700-20501722 GAGCCCTGCTCCTTGAGGATGGG + Intergenic
1146538476 17:33673837-33673859 GAGACCTGTCCTTTGAGCTGGGG + Intronic
1146662706 17:34675252-34675274 GATCCCTGGCCCCAGAGCAGGGG + Intergenic
1147551397 17:41445088-41445110 GAGACCTGCCCCTAGAGAAGAGG + Intergenic
1147880254 17:43648834-43648856 GAGCCCTGATCATTGAGCTGTGG - Intronic
1147992446 17:44343282-44343304 AAGCCGTGATTCTTGAGCAGCGG - Intergenic
1150186122 17:63183143-63183165 GAACCTTGACTCTTGAGTAGTGG + Intronic
1151665975 17:75545343-75545365 TAGCCCTGAGCCTTGGGCTGTGG - Intronic
1152254635 17:79230651-79230673 GAGCCCTCATCATTGAGGAGAGG + Intronic
1152642144 17:81453772-81453794 GGGCCCTGACCCTCGGGAAGAGG - Intronic
1152642443 17:81454823-81454845 GAGCCCTGGCTCCTGAGCACTGG + Intronic
1152685056 17:81689863-81689885 GAGCCCTGGCCAGAGAGCAGAGG + Intronic
1153043092 18:832429-832451 AAACCCTGACCCCAGAGCAGTGG + Intergenic
1156312647 18:35939046-35939068 GGGCCCAGACCTTTGAGGAGAGG + Intergenic
1157679202 18:49590627-49590649 CAGCCTTGACCCTGGAGCACTGG + Exonic
1157965749 18:52206253-52206275 GAGCCCTCCCACCTGAGCAGTGG - Intergenic
1160400943 18:78610989-78611011 GAGCCTTGACACTTGGGGAGAGG - Intergenic
1161052014 19:2169072-2169094 GAGTCCGGACCCTTGGCCAGTGG - Intronic
1162793096 19:13073097-13073119 GGGCACTGACCGTTGGGCAGTGG - Exonic
1165064498 19:33221086-33221108 GAGCCCTGGGCTTTGAGCAGAGG - Intronic
1165645380 19:37431518-37431540 GAGCCCTGAACAGTCAGCAGTGG + Intronic
1168415360 19:56164320-56164342 GAGCCGGAACCCTTTAGCAGGGG - Intergenic
1168544817 19:57241448-57241470 GAGGCCTGACACTTTAGCAGTGG - Intronic
926075651 2:9940926-9940948 CAGCTCTGACCCTTGGGCTGTGG - Intergenic
927151504 2:20198901-20198923 GAGGCCTGGCCATGGAGCAGAGG - Intergenic
928176070 2:29035268-29035290 GAGCCCTGGCCCCTGACAAGGGG + Intronic
930035066 2:47080171-47080193 GAGCCCTGGCCCTTGCGTGGGGG - Intronic
930530269 2:52580755-52580777 GAGCACTTACTCTGGAGCAGGGG - Intergenic
931214156 2:60226001-60226023 AAGCCCTTGCCCTTGAGCAATGG + Intergenic
931636533 2:64345318-64345340 GAGCTGTGACCACTGAGCAGAGG - Intergenic
932306643 2:70708302-70708324 GAGCCCTCAGCCTAGAGCAGTGG + Intronic
932425788 2:71634151-71634173 GGGCCTTGAACCTTGAGCATGGG + Intronic
933521400 2:83379479-83379501 GAGCCATTTCCCTTGAGAAGTGG + Intergenic
938064567 2:128274015-128274037 GGGCACAGACCCTTCAGCAGGGG - Intronic
943646010 2:190408440-190408462 GAGCCCTGTCCCCGGAGCACGGG - Exonic
944609788 2:201390848-201390870 GAGTCCTCACCCCTGACCAGAGG - Intronic
946166615 2:217868326-217868348 GAGGCAGGACCCCTGAGCAGAGG + Intronic
948204063 2:236152384-236152406 TAGCCTTGACCCATGAGAAGAGG - Intergenic
948864711 2:240769377-240769399 GATCCCTGACCATGGTGCAGAGG - Intronic
1169085062 20:2821253-2821275 GAGCGATGACCCTCGGGCAGAGG + Intergenic
1172100040 20:32479853-32479875 GAGCCCTGCCTCTGGGGCAGAGG + Intronic
1172627965 20:36359467-36359489 AAGCCCTGATCCTTCCGCAGGGG + Intronic
1173534443 20:43798726-43798748 GAGCCCAGCCCCATTAGCAGAGG + Intergenic
1174736361 20:52969528-52969550 GAGCTCTGTCACTTCAGCAGGGG - Intergenic
1175203405 20:57292888-57292910 GAGCCCAGACCAGTGTGCAGGGG + Intergenic
1175811712 20:61861942-61861964 GAGGCCTGCACCTTGAGGAGCGG - Intronic
1176516019 21:7784000-7784022 GAGATCTGAAACTTGAGCAGAGG + Intergenic
1178650047 21:34414012-34414034 GAGATCTGAAACTTGAGCAGAGG + Intergenic
1179222935 21:39425767-39425789 GTGCTCTGACCCTGGAGGAGAGG + Intronic
1179847395 21:44119133-44119155 GACCCCCGACCCCTGAGCAAGGG - Intronic
1180023810 21:45147027-45147049 GTGCCGTGACCCCTGAGGAGGGG - Intronic
1181435334 22:22907118-22907140 GAGCAGTGACCCTTCAGCACAGG - Intergenic
1181514080 22:23401686-23401708 GAGCCCTGCCTCTCCAGCAGAGG - Intergenic
1181589870 22:23877486-23877508 GAGCCTGGACCCTTGGGAAGAGG + Intronic
1182353363 22:29711073-29711095 GAGCCAGGAGCCTTGAGCAGGGG - Intergenic
1182583634 22:31330058-31330080 GACCCTTTACCCTTTAGCAGTGG - Intronic
1182661869 22:31930810-31930832 GAGACCTGAGCCTTGAACAATGG + Intergenic
1184402857 22:44283958-44283980 CAGCCTCCACCCTTGAGCAGTGG - Intronic
1184766034 22:46573082-46573104 GAGCCCTGACTGTTGAGGAGTGG + Intergenic
1184803144 22:46774657-46774679 GAGCTCGGGGCCTTGAGCAGAGG - Intronic
1185183997 22:49381708-49381730 GAGCCCTGAGCCCTGAGCTGGGG - Intergenic
1185401400 22:50619950-50619972 CAGCCCTGAGCCTGGTGCAGGGG - Intergenic
953637614 3:44676235-44676257 AAGCCCTGACCCATCAGCACTGG - Intergenic
953903536 3:46856990-46857012 GGGCCCTGGCCCCAGAGCAGGGG + Intergenic
954713881 3:52517612-52517634 GGGTCCTGACCTTAGAGCAGGGG - Exonic
955703580 3:61705794-61705816 GAGGACTGATGCTTGAGCAGAGG + Intronic
960605579 3:119501121-119501143 GAGCCTTGACGATTTAGCAGGGG - Intronic
968074272 3:195807995-195808017 GGGCCATGGCCCTAGAGCAGGGG - Intronic
968594096 4:1473472-1473494 CAGCCCTGACCCAGGAGCACAGG + Intergenic
969522199 4:7684893-7684915 GAGCCCTGACCCTGGGGCCAGGG + Intronic
969564155 4:7967808-7967830 GAGCCCACACCCTGGAGCTGTGG + Intronic
969849374 4:9944206-9944228 GAGGCTGGAGCCTTGAGCAGAGG + Intronic
973759090 4:54100651-54100673 GAGAACTGGCCCTTAAGCAGAGG - Exonic
978982699 4:114969011-114969033 GAGCCATGACTCTAGACCAGTGG - Intronic
983820343 4:172185102-172185124 CAGCCCTGTGCCTTGAGCTGAGG + Intronic
984643489 4:182196469-182196491 TTGCCTTGACCCTTGAGAAGAGG - Intronic
984833685 4:183999616-183999638 GAGGCCTGAGCCTTGGGCACTGG + Intronic
988539141 5:32093486-32093508 GGGCACTGACCTTCGAGCAGTGG + Intronic
992273691 5:75092058-75092080 GAGCCATGGCCCTGGAGCTGAGG - Intronic
996500486 5:124210941-124210963 GAGTCCTGCCCATTGAGCAAGGG + Intergenic
997361895 5:133300464-133300486 GTGCCCTGAGCATGGAGCAGTGG + Intronic
997386460 5:133476751-133476773 AAGCTCTGACCCTTGAATAGGGG - Intronic
998129377 5:139643592-139643614 GAGCCCTGCACCTGGAGGAGGGG - Intergenic
999421320 5:151447363-151447385 GAGCACTGTCCCTTGAGTTGTGG - Intronic
1001255487 5:170180007-170180029 CAGCCCTGACCCTGGAACTGAGG - Intergenic
1002889919 6:1323705-1323727 GGACTCTGAGCCTTGAGCAGGGG + Intergenic
1002932847 6:1646305-1646327 GAGCACGGACCCCAGAGCAGGGG - Intronic
1004560457 6:16744495-16744517 GAGCCCTGTCCTGGGAGCAGTGG - Intronic
1006939059 6:37739546-37739568 GGGCCCTGACCCCTGAGCATGGG - Intergenic
1007716480 6:43858993-43859015 GACCCCTGACCTTTGGGCACAGG + Intergenic
1015144569 6:129971284-129971306 GAGACCTGAGCATTGAGCATTGG + Intergenic
1017572746 6:155764826-155764848 GAACCCTGACAATTGAGGAGTGG + Intergenic
1018274494 6:162116107-162116129 GACACATTACCCTTGAGCAGGGG + Intronic
1018376573 6:163218751-163218773 GAGCCCTGCCCCTGCGGCAGAGG - Intronic
1018740699 6:166726435-166726457 GAGCCCAGACCCTGTAGCAGAGG + Intronic
1019276184 7:177237-177259 GAGCCCTCCCCCTTCAGCGGAGG + Intergenic
1019713085 7:2526208-2526230 GGGCCCAGACCAGTGAGCAGAGG - Intronic
1020759080 7:12245575-12245597 GAGCCCTGCAGCTTGAGCTGCGG - Intergenic
1024243114 7:47450586-47450608 GACCCAAGACCCTGGAGCAGAGG + Intronic
1024978351 7:55134113-55134135 GAGTCCTGACTCCTGAGCAGGGG - Intronic
1025072843 7:55916148-55916170 GAGCCATGCGCTTTGAGCAGAGG - Intronic
1031310499 7:120190974-120190996 GAGCCCTGACAAAAGAGCAGAGG - Intergenic
1033801655 7:144909089-144909111 GAGCCCTGATCTTTGAGCTGTGG + Intergenic
1033956417 7:146854242-146854264 TAGCCATGACCCTTCAACAGAGG - Intronic
1034909487 7:154982741-154982763 GGGCTCTCATCCTTGAGCAGTGG - Intronic
1034950442 7:155293059-155293081 CAGCCCTGAGGCTGGAGCAGAGG - Intergenic
1037892643 8:22631584-22631606 GGGCCCTGACCCTTGACCCTGGG + Intronic
1039641198 8:39225166-39225188 CACCCCTGACCCTGGAGCTGTGG + Intronic
1041084586 8:54244994-54245016 GAGCAGTGGGCCTTGAGCAGGGG - Intergenic
1047420277 8:124702361-124702383 GAGCCCTGAATCCTGAGCAGGGG + Intronic
1048010256 8:130449773-130449795 CAGCCCTGACCTTTGGGCAGTGG + Intergenic
1049449852 8:142654752-142654774 GCCCCTTGACCCTTGAGCTGGGG - Intergenic
1056879982 9:90381613-90381635 GATCTCTGATCCATGAGCAGGGG + Intergenic
1057316024 9:93969067-93969089 GAGCCCTGGGCCTCCAGCAGAGG + Intergenic
1058522829 9:105828811-105828833 GGGCCCTGAATCATGAGCAGGGG - Intergenic
1060881655 9:127122219-127122241 GAACCCTGACCCTCCAGCTGGGG - Intronic
1061391557 9:130319794-130319816 CAGCACTGACCATAGAGCAGAGG + Intronic
1061536341 9:131252522-131252544 GAGGCCGGAGCCCTGAGCAGAGG + Intergenic
1061615168 9:131774571-131774593 GAGCCAGAGCCCTTGAGCAGGGG - Intergenic
1196896435 X:120341405-120341427 GAGCCATGGCCCTGGAGCTGGGG + Intergenic
1197695052 X:129540787-129540809 GCGCCCTGACCCTAGCCCAGAGG + Exonic
1198427384 X:136533540-136533562 CAAGCCTGAACCTTGAGCAGTGG + Intronic
1201049616 Y:9918984-9919006 GAGCCCTGGCCCTAGTCCAGTGG - Intergenic
1201728318 Y:17179566-17179588 GAGCGCTGAACCTTGGGCACTGG + Intergenic
1201885822 Y:18880465-18880487 GACCCGTGGCCCTGGAGCAGGGG - Intergenic