ID: 916810447

View in Genome Browser
Species Human (GRCh38)
Location 1:168301023-168301045
Sequence GAGGATTCCCTCCACCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916810447_916810451 19 Left 916810447 1:168301023-168301045 CCAGGATGGTGGAGGGAATCCTC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 916810451 1:168301065-168301087 ACGATCAGTGACATCAGAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916810447 Original CRISPR GAGGATTCCCTCCACCATCC TGG (reversed) Intronic
900113809 1:1020315-1020337 GAGGATCTCCTCCACCGTCCCGG - Exonic
900402054 1:2476638-2476660 GAGGAGTACCTCCGCCAGCCAGG - Exonic
901728785 1:11262801-11262823 TAGGATTCCCTTCTGCATCCGGG + Intergenic
906203889 1:43976670-43976692 ATGGATTCCCGCCACCACCCTGG - Intronic
914505865 1:148288325-148288347 GAGGATCCTCTCGCCCATCCTGG - Intergenic
914506696 1:148295843-148295865 GAGGATCCTCTCGCCCATCCTGG + Intergenic
916810447 1:168301023-168301045 GAGGATTCCCTCCACCATCCTGG - Intronic
917410017 1:174749783-174749805 GAGGATTCCCTTCTCTTTCCAGG - Intronic
917479269 1:175396843-175396865 GAGGATTGCCTTCCCCATCCTGG + Intronic
917899478 1:179528082-179528104 GAGGATTTCTTCCAGCTTCCAGG - Intronic
919823456 1:201487478-201487500 TTGCATTTCCTCCACCATCCAGG + Intronic
919927556 1:202200152-202200174 GATCACTTCCTCCACCATCCCGG - Intronic
920697291 1:208190928-208190950 GAGGATTCCATCAACCTTCTGGG - Intronic
921331127 1:214037589-214037611 TATGATGCCCTGCACCATCCAGG + Exonic
924414417 1:243844502-243844524 GGGGTTTCCCCCCATCATCCAGG + Intronic
1063434894 10:6021693-6021715 GAGCATTCCTTCCATCTTCCAGG - Exonic
1065971621 10:30810315-30810337 GAGGATGGCCTCCTGCATCCAGG - Intergenic
1068942104 10:62690368-62690390 GAGGCTTCTCTCCACTATCATGG - Intergenic
1072189852 10:93070348-93070370 GAGGACTCTCTCAACCATTCCGG + Intergenic
1072691395 10:97574358-97574380 TGGAATACCCTCCACCATCCTGG - Intronic
1075291198 10:121232637-121232659 GAGGCTTCCCGCCAACAGCCAGG - Intergenic
1075853766 10:125610125-125610147 GAGAATTCCCTGCCCCTTCCCGG + Intronic
1076133091 10:128027350-128027372 TAGGCATCCCTCCACCATGCAGG - Intronic
1076829039 10:132985145-132985167 GAGGGTTCCCAGCACCAGCCTGG - Intergenic
1077127222 11:946038-946060 GAGGCCTCACTCCACCATTCCGG - Intronic
1080937646 11:36881083-36881105 CAGGATTTTCTCCACCCTCCTGG - Intergenic
1088772107 11:113045258-113045280 GTGGACTCCCTCCACCGTCATGG + Intronic
1089362180 11:117898210-117898232 GAGGAGGCCCTCCTCCACCCCGG - Intergenic
1091163125 11:133444832-133444854 GTGGTCTCCATCCACCATCCAGG - Intronic
1091163142 11:133444923-133444945 GTGGTCTCCATCCACCATCCAGG - Intronic
1091163158 11:133445014-133445036 GTGGTCTCCATCCACCATCCAGG - Intronic
1091163174 11:133445105-133445127 GTGGTCTCCATCCACCATCCAGG - Intronic
1091163191 11:133445196-133445218 GTGGTCTCCATCCACCATCCAGG - Intronic
1095627578 12:44334696-44334718 GAGGATTCCGTCCTACATCCAGG - Intronic
1104802326 12:131562487-131562509 GGGGAATGCCTTCACCATCCTGG - Intergenic
1105746124 13:23378352-23378374 GATGTGTCCCTCCACTATCCGGG - Intronic
1106113879 13:26800683-26800705 AAGGAGTCCTTCCACCATCTTGG + Intergenic
1112449264 13:99494249-99494271 GATGGTTCCCTCCACTATCGGGG + Intergenic
1113642404 13:111967204-111967226 GGGAACTCTCTCCACCATCCTGG + Intergenic
1113682368 13:112253387-112253409 GAGGATTCCGTTCACCCACCAGG - Intergenic
1121742809 14:96266071-96266093 CAGGATGCCCGCCACCATCAGGG + Intronic
1122769959 14:104093509-104093531 GAGGATTCTCTACACCGTGCTGG + Exonic
1123205902 14:106713191-106713213 GAGGGCTCCCTCCCCCATGCAGG - Intergenic
1123210982 14:106760596-106760618 GAGGGCTCCCTCCCCCATGCAGG - Intergenic
1123481578 15:20637641-20637663 GAGGGCTCCCTCCCCCATGCAGG - Intergenic
1123636434 15:22362724-22362746 GAGGACTCCCTCCCCCATGCAGG + Intergenic
1124356900 15:29002460-29002482 TAGGAGTCCTCCCACCATCCAGG - Intronic
1124365741 15:29070342-29070364 GGGGAGTCCCTCCTGCATCCCGG - Intronic
1127288254 15:57549008-57549030 GAGGACTCCTTCCAACTTCCTGG + Exonic
1129451489 15:75653582-75653604 GGGGATCCCCTCCCCCATCTGGG - Intronic
1130444571 15:83988501-83988523 GAGGAAACACTCCACCCTCCTGG + Intronic
1135046449 16:19159723-19159745 GACGATGCCCACCACCAGCCAGG - Intronic
1136276535 16:29182291-29182313 GAGGATGCCCTGCTCCATGCTGG + Intergenic
1138146113 16:54613116-54613138 GAGGACTCCCTCCACCAACATGG + Intergenic
1139447838 16:67009171-67009193 GGGGTTTGCCCCCACCATCCAGG + Exonic
1142003752 16:87679448-87679470 GAAGCTTCCCTCTTCCATCCTGG + Intronic
1142080913 16:88148352-88148374 GAGGATGCCCTGCTCCATGCCGG + Intergenic
1147433013 17:40385573-40385595 AAGGTTTCACTCTACCATCCAGG - Intergenic
1148159953 17:45444116-45444138 GAAGACTGCCTCCTCCATCCTGG - Intronic
1148458443 17:47823548-47823570 GTGGGTCCCATCCACCATCCAGG - Exonic
1149387142 17:56153450-56153472 GGGGTTTCCCTCCACCCCCCAGG + Intronic
1149653309 17:58292578-58292600 AAGGATTCATTCCACCTTCCTGG - Intergenic
1150210376 17:63438359-63438381 GAAGTCTCCCTCCCCCATCCTGG + Intronic
1150391243 17:64790995-64791017 GAAGACTGCCTCCTCCATCCTGG - Intergenic
1150410030 17:64935038-64935060 GAAGACTGCCTCCTCCATCCTGG - Intergenic
1153957805 18:10112987-10113009 AAGGATTTCCTCCATCATTCAGG - Intergenic
1156461827 18:37325582-37325604 GAGGTCTGCCTGCACCATCCAGG - Intronic
1157160026 18:45305428-45305450 GAGGATTCTGTCCAGGATCCTGG - Intronic
1158554844 18:58466552-58466574 GAGGGTTTCCACCACCATCCAGG - Intergenic
1160400128 18:78604132-78604154 TAGGATTTCCTCCACTGTCCGGG - Intergenic
1160696135 19:485497-485519 AAGGTCTCACTCCACCATCCAGG + Intergenic
1162085056 19:8243702-8243724 GAGGATTCCATCCATCTTCATGG + Intronic
1162145468 19:8610531-8610553 CGGGATGCCCTCCCCCATCCAGG + Intronic
1164565555 19:29323629-29323651 GTGGATTCCCCCAAACATCCTGG - Intergenic
1165306510 19:35005956-35005978 TGGGATTCCCTCCACCACCTGGG - Intronic
1167055397 19:47108061-47108083 GAGGAGTCCCTCCACCAATGAGG + Intronic
1167601077 19:50455195-50455217 GAGGATGCCCTCGATCATCTTGG - Exonic
1168516911 19:57016612-57016634 GGGGGCTCCCTCCAGCATCCTGG + Intergenic
926712289 2:15891210-15891232 GAGGAGCCCCACCCCCATCCAGG + Intergenic
928454311 2:31405392-31405414 AAGGAGTCCCCCCACCCTCCAGG + Intronic
935830947 2:107000146-107000168 GTGGCTGCCCTCCACCAGCCAGG - Intergenic
940012018 2:149064753-149064775 GAGAATTCCCACCAGCCTCCAGG - Intronic
944630474 2:201619016-201619038 GAGGAATCCCTACAGCAGCCCGG - Exonic
948275232 2:236703374-236703396 GAGGATTCCTTTCTCCATCTGGG - Intergenic
948738897 2:240030172-240030194 GAGGAAGCCCTCCAGCATCTTGG + Exonic
948740971 2:240045815-240045837 GAGGAAGCCCTCCAGCATCTTGG + Exonic
1168856680 20:1013703-1013725 CAGGATTGCATTCACCATCCAGG + Intergenic
1169073860 20:2749896-2749918 GAGGGTCACCTCCACCACCCCGG - Exonic
1170435117 20:16318459-16318481 GTGTATTCCCTGCCCCATCCTGG - Intronic
1170693807 20:18639030-18639052 ATGGAATCCCTCCACCATGCTGG - Intronic
1171154735 20:22861603-22861625 GAGGATGCCCTCTGCAATCCTGG + Intergenic
1171972467 20:31572994-31573016 TTGGATTCCCTCCAGCATTCCGG + Intronic
1175298948 20:57929112-57929134 GAGCATCCCTTCCACCATACCGG + Intergenic
1176745376 21:10647676-10647698 GAGGGCTCCCTCCCCCATGCAGG - Intergenic
1177628136 21:23691334-23691356 GTGAATTACCTCCACAATCCAGG + Intergenic
1178520946 21:33288116-33288138 GAGGATGACGGCCACCATCCAGG - Exonic
1179783647 21:43718270-43718292 GCGGCTTCCCTGCACCACCCCGG - Intergenic
1180595188 22:16968342-16968364 TGGCATTCCCTCCACCATGCTGG + Exonic
1180793874 22:18592363-18592385 TAGGATTCCTTCCCCCACCCTGG - Intergenic
1181227866 22:21402957-21402979 TAGGATTCCTTCCCCCACCCTGG + Intergenic
1181250786 22:21531882-21531904 TAGGATTCCTTCCCCCACCCTGG - Intergenic
1183652580 22:39166780-39166802 GAGGAATCCCTTCACATTCCTGG + Intergenic
1184452386 22:44590853-44590875 GACAATTACCTCCACCAGCCTGG - Intergenic
949702681 3:6777179-6777201 GAGGGCTCCCTCCACCAGCCAGG + Intronic
950739002 3:15034748-15034770 CATGAGTCTCTCCACCATCCTGG + Exonic
950854894 3:16095700-16095722 TAAGATCCCCACCACCATCCAGG - Intergenic
952232702 3:31448214-31448236 GGGGGATCCCTCCCCCATCCTGG - Intergenic
953532152 3:43748497-43748519 GAGCCTTTCCTCCTCCATCCTGG + Intergenic
953664435 3:44915901-44915923 TGGTATTCCATCCACCATCCTGG + Intronic
953986702 3:47449428-47449450 AAGGATTCCCTCCATGCTCCTGG + Intronic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
954429717 3:50464066-50464088 GAGAACTCCCTCCATCACCCAGG + Intronic
954882857 3:53847131-53847153 GAAGATTCCCTCGATCATTCAGG - Intronic
956731169 3:72197976-72197998 GAGTATTTCCCCCACCTTCCAGG - Intergenic
957677888 3:83393776-83393798 GACCATTGCCTGCACCATCCTGG + Intergenic
958119260 3:89263348-89263370 GAGGCTGCCCTCCACCAGCAAGG + Intronic
960358156 3:116678658-116678680 GTGGCTTCTCTCCAACATCCGGG - Intronic
964740012 3:159955233-159955255 CAGGATGACCTCCATCATCCTGG + Intergenic
964848460 3:161068835-161068857 CAGGATTCCCTGGACCCTCCAGG - Exonic
965970534 3:174549769-174549791 GAGGAATCCCCTCCCCATCCAGG + Intronic
967511064 3:190312993-190313015 GAGGATGCCAACCACCATCAAGG + Exonic
968200855 3:196753762-196753784 GAAAATTCCTACCACCATCCAGG - Intronic
971551456 4:27962863-27962885 AAAGCTTCCCTCCACCTTCCAGG + Intergenic
972819148 4:42679598-42679620 GAAGGGTCCCTCCACCCTCCTGG + Intergenic
976698507 4:87943850-87943872 GAGTATCCCCTCCAACATCAAGG - Intergenic
980223371 4:129948227-129948249 GGGAATTCCCTCCACTAGCCAGG - Intergenic
981284353 4:142998028-142998050 GAGGTTTCCCTGTGCCATCCAGG + Intergenic
982225937 4:153166569-153166591 GAGGTCTCACTCCACCACCCAGG + Intronic
985955652 5:3263608-3263630 CAGAAATCCCTCCACCTTCCTGG + Intergenic
986613078 5:9589463-9589485 GAGGACACCCTCAACCCTCCAGG + Intergenic
987654949 5:20795633-20795655 GAGGGCTCCCTCCCCCAACCAGG + Intergenic
988740697 5:34066304-34066326 GAGGGCTCCCTCCCCCAACCAGG - Intronic
989471795 5:41828051-41828073 GAAGATTCCACCCATCATCCTGG + Intronic
990714745 5:58624269-58624291 GAGGATGCCCAACACCATCCTGG + Intronic
991411691 5:66352351-66352373 GAAGAATCCAGCCACCATCCAGG + Intergenic
996121884 5:119681712-119681734 GTGGGTCCCATCCACCATCCAGG + Intergenic
999768372 5:154756817-154756839 GTGGTTTCCCTCCCCGATCCCGG + Intronic
1001596703 5:172903152-172903174 GAGGACTCCCTCCTCCACTCAGG + Intronic
1001888408 5:175317352-175317374 GAGGTTTCCTTCCACCAACATGG + Intergenic
1002173186 5:177386477-177386499 CAGGATCCCCACCACCAGCCCGG - Exonic
1002527779 5:179824421-179824443 CAGGATACCCCCCACCTTCCTGG + Intronic
1005747144 6:28848854-28848876 GAGGACCCCCTCCCCCAGCCAGG - Intergenic
1009938177 6:70257927-70257949 GAGCATACCCTCTTCCATCCTGG + Intronic
1009939047 6:70268238-70268260 AAGGTCTCCCTCCACCACCCAGG + Intronic
1010124787 6:72419285-72419307 GTGCATTCCCTTCACCCTCCTGG - Intergenic
1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG + Intronic
1013841077 6:114394503-114394525 GAGGATGCCATCCACGATTCTGG - Intergenic
1017662823 6:156690536-156690558 GAGGATTCCCTTGGCCATCGTGG - Intergenic
1018857991 6:167689189-167689211 GGAGATTCGCTCCACCATTCTGG - Intergenic
1023807096 7:43880369-43880391 GAAGATTCCATTCACCATCCAGG + Intronic
1023911455 7:44559748-44559770 GAGGATTTCTACCACCACCCAGG + Intergenic
1026578887 7:71597480-71597502 GGGGATTCACTCCATCACCCAGG - Intronic
1027023832 7:74836301-74836323 GAGGAATGTCACCACCATCCTGG + Exonic
1027064097 7:75109020-75109042 GAGGAATGTCACCACCATCCTGG - Exonic
1027164079 7:75822388-75822410 GCCTACTCCCTCCACCATCCTGG - Intronic
1029713108 7:102310518-102310540 GAAGGTTGGCTCCACCATCCAGG + Intronic
1032343277 7:131095554-131095576 GTGGTTTCCCTCCACAATGCAGG + Intergenic
1035666967 8:1386479-1386501 CAGAATTCCCTCCAGAATCCTGG + Intergenic
1036407475 8:8468154-8468176 GAAGATTCCTCCCTCCATCCTGG + Intergenic
1037814647 8:22105596-22105618 AAGGATTCCTACCACCCTCCAGG + Intergenic
1044789215 8:95829591-95829613 GAGAACTTCCTCCACAATCCTGG - Intergenic
1049779769 8:144423564-144423586 GTGTATTCTCTCCACCCTCCTGG - Intergenic
1054354368 9:64047394-64047416 TAGGATCACCTCCACCAGCCAGG - Intergenic
1056602435 9:88056587-88056609 GATGAGTCCCTCCTCCATGCTGG - Intergenic
1058150129 9:101454517-101454539 GAGCTGTCCCGCCACCATCCAGG + Intergenic
1061074364 9:128332260-128332282 GGGGATGCCCACCAACATCCTGG + Exonic
1061681643 9:132245346-132245368 CAACATTCCCTCCACCCTCCGGG - Intergenic
1061837138 9:133336802-133336824 TACGATTCCCTCCCCCACCCCGG + Intergenic
1187629424 X:21152381-21152403 CAGGATGGCCTCCATCATCCAGG + Intergenic
1188887657 X:35569967-35569989 GAGGATGCCACCCACCAACCAGG + Intergenic
1189401587 X:40674428-40674450 GAGGATTCTCTGCACAATGCTGG + Intronic
1190878190 X:54474583-54474605 GAGGAGCGCCTCCTCCATCCTGG - Intronic
1194812282 X:98401119-98401141 GAGAATTGCCTCCACAATCCAGG + Intergenic