ID: 916810968

View in Genome Browser
Species Human (GRCh38)
Location 1:168305258-168305280
Sequence ATGGATAAACAGCTAGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916810959_916810968 16 Left 916810959 1:168305219-168305241 CCCTTGGGGTATGGGCTGGGGTG 0: 1
1: 0
2: 1
3: 25
4: 199
Right 916810968 1:168305258-168305280 ATGGATAAACAGCTAGGAAAAGG 0: 1
1: 0
2: 1
3: 37
4: 411
916810960_916810968 15 Left 916810960 1:168305220-168305242 CCTTGGGGTATGGGCTGGGGTGG 0: 1
1: 0
2: 3
3: 53
4: 472
Right 916810968 1:168305258-168305280 ATGGATAAACAGCTAGGAAAAGG 0: 1
1: 0
2: 1
3: 37
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916810968 Original CRISPR ATGGATAAACAGCTAGGAAA AGG Intronic
900976889 1:6023180-6023202 ATGGATAAAAAGATACGCAAAGG - Intronic
901283927 1:8061286-8061308 CAGGCTACACAGCTAGGAAATGG + Intergenic
902645399 1:17794267-17794289 AAGGTCACACAGCTAGGAAATGG - Intronic
902830518 1:19009459-19009481 AAGATTAAACAGCCAGGAAATGG + Intergenic
903434559 1:23336873-23336895 TTAGATAAACAGCTTTGAAAAGG - Intronic
903801149 1:25969306-25969328 GAGGAAGAACAGCTAGGAAAGGG - Intronic
904368570 1:30034228-30034250 AAGGACACACAGCTAGGAAGGGG - Intergenic
904707112 1:32399826-32399848 AAGGTAACACAGCTAGGAAATGG + Intergenic
904780624 1:32944355-32944377 AAGGTTATACAGCTAGTAAATGG - Intronic
907615917 1:55926745-55926767 ATAGAAAAACAATTAGGAAAGGG - Intergenic
907739240 1:57148105-57148127 ATGGAGAGACAGCTTGAAAATGG + Intronic
907830433 1:58059828-58059850 AGGGTTACACAGCTAGGAAATGG + Intronic
907940371 1:59081873-59081895 ATGCAAAATCAGCCAGGAAAGGG + Intergenic
907995758 1:59630408-59630430 ATGGAGGAACAGCAAGGACAGGG + Intronic
908173449 1:61530478-61530500 AAGGTTACACAGCCAGGAAATGG + Intergenic
908518341 1:64916353-64916375 ATGAAAACACAGCTGGGAAAGGG + Intronic
908711721 1:67023175-67023197 TTGGGTAAATAGCTAGAAAATGG + Intronic
908985523 1:70014879-70014901 ATGAAGAAACTGCTAGAAAAGGG - Intronic
909646906 1:77927688-77927710 ATGGTTACACAGTTAGTAAATGG - Intronic
909923841 1:81414941-81414963 ATGAATAACCAGATGGGAAACGG - Intronic
915202973 1:154246833-154246855 ATGGAGACACAGCTAGTAAGTGG - Intronic
915676131 1:157533735-157533757 ATGGATAAAAAGATAGTAATGGG + Intronic
915745633 1:158154872-158154894 ATGGACAAACATCGAGGCAAGGG + Intergenic
916405887 1:164497485-164497507 AGGGAGAAACAGCAAGGAAATGG + Intergenic
916810968 1:168305258-168305280 ATGGATAAACAGCTAGGAAAAGG + Intronic
916926657 1:169528330-169528352 AGTGATAAACTGCTTGGAAAGGG - Intronic
917653247 1:177100039-177100061 AAGGATACAAAGCTAGTAAATGG + Intronic
917901612 1:179548390-179548412 AAGGTTAAACAGTTAGTAAATGG + Intronic
918001797 1:180503707-180503729 AAGGCTACACAGCTAGCAAATGG + Intergenic
918116271 1:181500714-181500736 AGGGATACTCAGCTTGGAAAGGG - Intronic
920127686 1:203706587-203706609 ATTGATAAACTACTATGAAATGG + Intronic
920816663 1:209340848-209340870 GTGAACAAACAGCCAGGAAAAGG - Intergenic
921480753 1:215662153-215662175 CTGTAAAAACATCTAGGAAAGGG - Intronic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
922165006 1:223108152-223108174 CTGGATTAGCAGCTAGGAACGGG - Intergenic
923243748 1:232110907-232110929 ATGGATTCACAGCTGGGAACTGG - Intergenic
923439299 1:234000640-234000662 ATGGAACAGAAGCTAGGAAAGGG + Intronic
1063225488 10:4011726-4011748 ATGGATAAAAAGCCTGGCAAGGG + Intergenic
1063595803 10:7434634-7434656 AAGGCCACACAGCTAGGAAAAGG + Intergenic
1064142395 10:12801510-12801532 ATGGATAAACAAATAGAAGATGG - Intronic
1065056367 10:21847061-21847083 AGAGCTAAACAGCTAGAAAAGGG - Intronic
1066945634 10:41909289-41909311 ATGGAAAAAAAGCGAGGGAATGG + Intergenic
1068012950 10:51477489-51477511 AGGGACACACAGCTAGTAAATGG - Intronic
1068344074 10:55747975-55747997 ATGGAAAAACAGATAGGGCACGG - Intergenic
1068868778 10:61921825-61921847 ATAGATAAACAACTAATAAAAGG - Intronic
1068893400 10:62172217-62172239 GTGGTTACACAGCTAGTAAATGG - Intergenic
1069020530 10:63482711-63482733 ATGGTAACACAGCTAGTAAATGG - Intergenic
1070042095 10:72791982-72792004 AAGGTCAAACAGCTAGGAAGTGG - Intronic
1070636936 10:78136498-78136520 AAGGACACACAGCTAGAAAAGGG - Intergenic
1071355369 10:84788458-84788480 AAGGCTAAACAGCTAGTAAGTGG - Intergenic
1071396368 10:85227864-85227886 ATGGAAATACAGCTGAGAAATGG + Intergenic
1071757328 10:88558168-88558190 AAGGATAAATTGCTAGGAGAGGG + Intronic
1072138077 10:92565937-92565959 AAGGATACACAGCTAGTAAGTGG - Intronic
1072176760 10:92931922-92931944 ATGGATAAATACCTAGGAGCAGG - Intronic
1074212170 10:111345456-111345478 ATGGAGAAAAAGCTACTAAAAGG + Intergenic
1074598470 10:114889227-114889249 ATGGAGAATCAGCAAAGAAAAGG + Intronic
1074757914 10:116640277-116640299 AAGAATAAACAACGAGGAAAGGG - Intronic
1074840910 10:117350182-117350204 AGGGATACACAGCTAGTAAGTGG + Intronic
1075246910 10:120830678-120830700 CCGGAAAAACAGTTAGGAAATGG + Intergenic
1075811769 10:125229331-125229353 AAGGTCAAACAGCTAGTAAATGG + Intergenic
1076078489 10:127556649-127556671 AAGGAGAAACAGCAAGGAAGGGG + Intergenic
1076391360 10:130105334-130105356 AAGGATACACAGCTAGTAAATGG - Intergenic
1076939887 10:133597008-133597030 ATAGAGAAACAGCTAGAATATGG - Intergenic
1077451917 11:2653579-2653601 ATGGATAGAGAGCAAGGGAAAGG - Intronic
1078795600 11:14589279-14589301 ATGGAAAAACAAAAAGGAAAAGG - Intronic
1079207317 11:18427459-18427481 ATGGTTACACAGCTAGTAAGTGG + Intronic
1079722570 11:23836839-23836861 AATGATAATCAGCAAGGAAATGG - Intergenic
1079732521 11:23952759-23952781 ATGGAGAAACATCTAGAAATAGG - Intergenic
1080204276 11:29711384-29711406 ATGCATCACCAGCTATGAAAAGG - Intergenic
1080294519 11:30710810-30710832 AAGGTTAAAGAGCTAGGAACTGG - Intergenic
1080550789 11:33372590-33372612 AAAGTTAAACAGCTAGTAAACGG + Intergenic
1080856742 11:36118270-36118292 AAGGTCACACAGCTAGGAAATGG + Intronic
1081523042 11:43901432-43901454 ATGGAAAAACAGAAAAGAAAGGG - Intronic
1082640004 11:55647823-55647845 ATGGAGAAATAGCTGGGATAAGG - Intergenic
1082943859 11:58737522-58737544 ATAGATAAACATCTAGGGTAAGG - Intergenic
1083265500 11:61544967-61544989 ATGGCCCAACAGCTAGGAAGGGG + Intronic
1083960303 11:66011669-66011691 GAGGTTACACAGCTAGGAAATGG + Intergenic
1084221240 11:67680996-67681018 ATGCCTAAACAGCTGGGCAAAGG + Intronic
1086181288 11:83955254-83955276 AAGGTCACACAGCTAGGAAATGG + Intronic
1086326285 11:85703663-85703685 AAGGATAAAGAGCAAGGGAAAGG + Intronic
1086377276 11:86214207-86214229 ATGGATATATAGATAGGAAATGG - Intergenic
1087032867 11:93723616-93723638 ATGGTTTTACAGCTAGGAAATGG - Intronic
1087163618 11:94975412-94975434 AAGGTTATAGAGCTAGGAAAGGG - Intronic
1087223344 11:95570017-95570039 ATGGCTAAACAGTTAGGATGTGG - Intergenic
1087252234 11:95915734-95915756 ATGGATACATGGCTTGGAAATGG + Intronic
1087386409 11:97474621-97474643 ATGTATAAAGAGGGAGGAAATGG - Intergenic
1088940996 11:114455889-114455911 ATGGCTAAACTGCTAAAAAATGG - Intergenic
1089076279 11:115741370-115741392 ATGAATAAACAGCCTCGAAAGGG + Intergenic
1089780200 11:120868474-120868496 ATGGAAAGACAGAAAGGAAAAGG + Intronic
1090666100 11:128916061-128916083 ATGGAAAAAAAGGCAGGAAAGGG - Intronic
1090666118 11:128916157-128916179 ATGGAAAAAAAGGCAGGAAAGGG - Intronic
1091190674 11:133693132-133693154 AGGAATAAACAGCTGGAAAATGG - Intergenic
1093172158 12:15873612-15873634 AGGGATAAACAAGTAGAAAAAGG - Intronic
1094066641 12:26368545-26368567 AAGGTCACACAGCTAGGAAATGG + Intronic
1094372680 12:29754872-29754894 AAGTATAAAGAGGTAGGAAATGG + Intronic
1094686052 12:32715882-32715904 ATGGTTAAACACCTAGGAACGGG - Intronic
1094686139 12:32716902-32716924 ATGGTTAAACACCTAGGAATGGG + Intronic
1095246034 12:39922525-39922547 AAGGATAAACAGCTGAAAAATGG + Intronic
1096371137 12:51070016-51070038 ATGGATAGAGAGCCAAGAAAGGG + Intronic
1098065818 12:66614964-66614986 AAGGAGAAGCAGCTTGGAAAAGG - Intronic
1098111038 12:67122130-67122152 ATGGATAATCAGTTTGGGAAAGG + Intergenic
1098381891 12:69878793-69878815 ATGGATACACAGCTAGGAAGTGG + Intronic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1099918380 12:88925098-88925120 ATGGGTAAGCTGCTAAGAAAAGG + Intergenic
1100023157 12:90096234-90096256 ATGACTACACAGCTAGGAAAAGG + Intergenic
1100760669 12:97803528-97803550 ATGGCTACACAGCTAGTGAATGG - Intergenic
1101528714 12:105555628-105555650 AAGGACACACAGCTAGGAAGTGG + Intergenic
1101557631 12:105825050-105825072 AGGGATAAACAGCTGTGAAGTGG - Intergenic
1101801078 12:108022397-108022419 ATGGGTAAGCAGATGGGAAATGG - Intergenic
1103981178 12:124737984-124738006 AAGGGCACACAGCTAGGAAATGG - Intergenic
1105359816 13:19699368-19699390 ATGGATACTCACTTAGGAAATGG + Intronic
1105788995 13:23779379-23779401 AGTGATAATCAGCTAGAAAAAGG + Intronic
1105792013 13:23810834-23810856 ATAGAAGAACTGCTAGGAAACGG + Intronic
1106290012 13:28352192-28352214 AGGGTTACACAGCTTGGAAATGG - Intronic
1106939481 13:34762099-34762121 ATGGGCACACAGCTAGAAAATGG - Intergenic
1107350846 13:39513016-39513038 ACAGATACACAGCTAGCAAATGG - Intronic
1107569381 13:41640609-41640631 ATGGGTAAAAAGCTAGAAATGGG - Intronic
1107722943 13:43267760-43267782 TTGGACAAACAGCTTGGTAATGG + Intronic
1108687201 13:52830311-52830333 AAAGTTAAACAGCTAGTAAATGG - Intergenic
1109287095 13:60422321-60422343 ATGGATTGACTGGTAGGAAAGGG + Intronic
1109729597 13:66394467-66394489 ATTGATAAACAGTAAAGAAAAGG - Intronic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110419571 13:75290856-75290878 ATAGGTACACAGCTAGTAAATGG + Intronic
1110890993 13:80698033-80698055 GTGTATACACAGCTAGGAAGTGG + Intergenic
1112682632 13:101784658-101784680 ATGGGAAAATAGCTGGGAAATGG - Intronic
1114400358 14:22404670-22404692 TTGGATAAGCAGGAAGGAAAAGG + Intergenic
1116052124 14:39817052-39817074 TTGGATAAACACCTAGAAATGGG + Intergenic
1117279222 14:54220854-54220876 ATGAACAAGGAGCTAGGAAATGG + Intergenic
1117301587 14:54434716-54434738 ATTAATAAACAGCTATCAAAAGG + Intronic
1117722517 14:58641499-58641521 ATGAATAATCATTTAGGAAAAGG - Intronic
1117972250 14:61263504-61263526 AAGGACACACAGCTAGGAAGGGG + Intronic
1118555625 14:67017026-67017048 AAGGTTACACAGCTAGGAAGAGG + Intronic
1118925069 14:70184701-70184723 AAGGATAACCAGCTAGTGAATGG - Intronic
1119033544 14:71211144-71211166 AAGGTCACACAGCTAGGAAAGGG + Intergenic
1119053569 14:71394811-71394833 ATGGATAAGCAGTAAGGAGAAGG + Intronic
1119629268 14:76212593-76212615 GTGGATAAAAAACTAGGACATGG + Exonic
1119966824 14:78925815-78925837 AAGGTCACACAGCTAGGAAAGGG - Intronic
1120228922 14:81821765-81821787 ATGGAGAAGCAGCTAGACAAAGG + Intergenic
1121167149 14:91814560-91814582 ATGGAGAAAGAGGTAAGAAAAGG + Intronic
1121323355 14:93005714-93005736 TAGGATAAACACCTAGGAATCGG - Intronic
1122332214 14:100929013-100929035 AGGGAGAAGCAGATAGGAAAAGG + Intergenic
1122908593 14:104815376-104815398 ATGCAGACACAGCAAGGAAAGGG - Intergenic
1202921463 14_KI270723v1_random:33174-33196 ATGGAAGAACGGCTTGGAAATGG - Intergenic
1126180430 15:45780117-45780139 ATGCATAAAAAGCTTTGAAATGG - Intergenic
1126461613 15:48920599-48920621 ATAGATAAATGGCTGGGAAAAGG + Intronic
1126711072 15:51456776-51456798 ATGAATAAACAGATACAAAATGG - Intronic
1127978632 15:64017611-64017633 CTGGAGACACAGCTAGGAAGAGG - Intronic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1129110227 15:73332840-73332862 AAGGTTACACAGCTAGGAACTGG - Intronic
1129556286 15:76513340-76513362 ATGTATAAACTGTTAGGGAATGG - Intronic
1130778893 15:87013917-87013939 AAGGATGTACAGCTAGGAAAGGG - Intronic
1131854500 15:96579161-96579183 ATGGTCACCCAGCTAGGAAATGG + Intergenic
1132350220 15:101134867-101134889 TTGGATAAATACCTAGGAGAGGG + Intergenic
1132632012 16:922472-922494 GTGGACAAACAGCTGAGAAAAGG + Intronic
1132955592 16:2591595-2591617 TCAGATAAACAGCTAGAAAAGGG - Intronic
1133083872 16:3346317-3346339 ATGAATAAATAAATAGGAAAAGG + Intergenic
1133114624 16:3570066-3570088 AAGGATACACAGCTGGGAAGTGG + Intronic
1133416387 16:5610419-5610441 AAGGTCACACAGCTAGGAAAGGG + Intergenic
1134796391 16:17040905-17040927 AAGGTCACACAGCTAGGAAAGGG + Intergenic
1135639249 16:24106177-24106199 AAGGGTACACAGCTAGGAAGTGG - Intronic
1135717748 16:24787042-24787064 ATGGTCACACAGCTAGTAAATGG + Intronic
1136071383 16:27789616-27789638 ATGGATAAATAGCTAACGAATGG + Exonic
1137750969 16:50860839-50860861 AAGGACACACAGCTAGGAAGTGG + Intergenic
1138600047 16:58048802-58048824 AAGGTCACACAGCTAGGAAATGG + Intergenic
1138644612 16:58415187-58415209 ATAGAAAAAAAGCTTGGAAATGG - Intergenic
1139960179 16:70713014-70713036 GAGGATCAACAGCCAGGAAAAGG + Intronic
1140659408 16:77173428-77173450 AGGGAGAAACTGCTAGAAAATGG + Intergenic
1140721849 16:77779285-77779307 ATGGTTACATAGCTAGGAAAAGG + Intergenic
1142770433 17:2092822-2092844 AAGGATAAACAGCCAGGAAGTGG - Intronic
1143875227 17:9986199-9986221 AGGAATAAACAGCAGGGAAAAGG + Intronic
1144260435 17:13514054-13514076 CTTGATAAACATCTGGGAAATGG - Intronic
1146706089 17:35001779-35001801 AAAGATAAAGAGCAAGGAAAAGG - Intronic
1148283041 17:46363764-46363786 ATGGAGAAACAGGTAGGAGGTGG - Intergenic
1148305258 17:46581689-46581711 ATGGAGAAACAGGTAGGAGGTGG - Intergenic
1149347034 17:55749394-55749416 GTCTAAAAACAGCTAGGAAAGGG - Intergenic
1149777534 17:59370020-59370042 AAGGAGACCCAGCTAGGAAATGG + Intronic
1150059847 17:62057579-62057601 ATAGATAAACAGCCAGGCATAGG - Intronic
1151326030 17:73380233-73380255 CTGCATAGACAGCTAGGCAAGGG - Intronic
1153606648 18:6840431-6840453 ATGTAAAAACAGCAAGGTAAAGG + Intronic
1154229072 18:12538094-12538116 AAGGATACACAGCTAGTCAATGG + Intronic
1157608582 18:48941682-48941704 ATGGAAAAACAGGTAGAAATAGG + Intronic
1158753674 18:60297157-60297179 ATGGAAAAGCAGGTAAGAAATGG + Intergenic
1161497722 19:4596736-4596758 CTGGACAAACAGCAAGAAAATGG + Intergenic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1166804104 19:45474530-45474552 AGGGATAAATAGCTAAGGAATGG - Exonic
1167222684 19:48212902-48212924 AGGCAACAACAGCTAGGAAATGG + Intronic
1167404674 19:49297575-49297597 TTGGATAAACACCTAAGAGAAGG - Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168347473 19:55657817-55657839 AAGGTCAAACAGCTAGGAAATGG - Intronic
1168680097 19:58308635-58308657 CTGGGCAAACAGATAGGAAAGGG + Intronic
925475266 2:4206297-4206319 ATGCAGAAATATCTAGGAAAAGG + Intergenic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
926611664 2:14953832-14953854 ATGGATAAAAAGTTATAAAAAGG + Intergenic
927244327 2:20944697-20944719 ATGAATAATCAGTGAGGAAACGG - Intergenic
927342063 2:21993595-21993617 TTGGAGAAACAGCAAGAAAAAGG - Intergenic
927643656 2:24861535-24861557 ATGGAAAAACACTTTGGAAAGGG - Intronic
928807916 2:35183832-35183854 TAGGTTAAACAGCTAAGAAATGG + Intergenic
929395229 2:41514724-41514746 GTGGATCAACATCTATGAAAGGG + Intergenic
929616099 2:43309327-43309349 TTGGGTAAAAACCTAGGAAAGGG - Intronic
929893574 2:45938659-45938681 ATGGTCAAACAGCCAGGGAAAGG - Intronic
929979008 2:46661676-46661698 ATGGGTAAACAGCAAGGGCAGGG + Intergenic
932758194 2:74423122-74423144 AAGGACATACAGCTAGTAAAGGG - Intronic
933037976 2:77425263-77425285 ATGTATAAAAAGTCAGGAAATGG - Intronic
933980835 2:87549627-87549649 ATGGAAAAACAGGTAGGCAAGGG - Intergenic
934058584 2:88273484-88273506 ATGGAAAAAGCGCTAAGAAATGG + Intergenic
935389911 2:102540181-102540203 AAGGACATACAGCTAGTAAATGG + Intergenic
935926418 2:108074531-108074553 ATGGATAGGCAGGAAGGAAAGGG - Intergenic
936312995 2:111401158-111401180 ATGGAAAAACAGGTAGGCAAGGG + Intergenic
936926519 2:117742467-117742489 AAGAATAAAGAGCTTGGAAATGG + Intergenic
936954514 2:118011221-118011243 ATGTATAAACTGCCAGGAAAGGG + Intronic
937567970 2:123319232-123319254 GTGAATAAACAGATTGGAAATGG + Intergenic
938017580 2:127880278-127880300 ATGGATGAACAGGAAGAAAAGGG - Intronic
938800991 2:134763186-134763208 AAGGACACACAGCTAGGAAGTGG + Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939656443 2:144831755-144831777 CATAATAAACAGCTAGGAAAAGG + Intergenic
940486191 2:154298164-154298186 ATGGATAAACATATAAGAAGAGG + Intronic
940974018 2:159923493-159923515 ATGGATAAATATCTGGGAGAAGG + Intergenic
941086383 2:161122964-161122986 ATGGACCAACAGGTAGGAGAAGG - Intergenic
941275416 2:163484765-163484787 CTGTATAAACAGCAATGAAATGG + Intergenic
941350871 2:164433574-164433596 CTGGATAAACAACTATGAACAGG + Intergenic
945120410 2:206451652-206451674 AAGGACAAATAGCTAGTAAATGG + Intronic
945923721 2:215782480-215782502 AAGGTTACACAGCTAGGAAGTGG + Intergenic
946943785 2:224798312-224798334 GGGGAGAAACAGCTAGTAAAAGG + Intronic
947958103 2:234212569-234212591 CTGGAAAAACAGGAAGGAAAGGG + Intergenic
948165614 2:235859569-235859591 ATGGAAATACAGTTAGAAAAGGG - Intronic
948254760 2:236558312-236558334 ATTCAGAAATAGCTAGGAAATGG + Intergenic
948612202 2:239176972-239176994 TCGGATAAATAGCTAGGAATGGG - Intronic
1169070070 20:2720739-2720761 TTGGATCAACAGAAAGGAAATGG - Intronic
1170479733 20:16754042-16754064 AAGTATACACAGCTAGAAAACGG - Intronic
1170935408 20:20805266-20805288 ATGGGGATACAGCTATGAAAGGG - Intergenic
1170979946 20:21202750-21202772 ATGGATAAACAAATATGAGAGGG - Intronic
1172128906 20:32642822-32642844 ATGGTTACACAGCAAGGAGATGG - Intergenic
1172923082 20:38503726-38503748 ATGGGTAAAATGCTATGAAATGG + Intronic
1172966728 20:38840769-38840791 AAGGATGCACAGCTAGTAAACGG - Intronic
1173406358 20:42769335-42769357 GTGGAGAGACAGCTAGGCAAAGG + Intronic
1173876756 20:46377469-46377491 CTAGAGAAACAGCTAGAAAAAGG - Intronic
1174389964 20:50213003-50213025 GTAAATAAACAGCTAGTAAATGG + Intergenic
1174834220 20:53840701-53840723 ATGGTTAAATAGCTGGAAAATGG + Intergenic
1176990947 21:15495819-15495841 ATGGATACACAGCTATGAGGAGG - Intergenic
1177444865 21:21181149-21181171 ATGGAAAAATATCTAGGCAAAGG - Intronic
1178784301 21:35638277-35638299 ATGCAGCACCAGCTAGGAAATGG - Intronic
1179645931 21:42776119-42776141 ATTTATAAAAAGCAAGGAAAAGG + Intergenic
1180930186 22:19584918-19584940 ATTCAGAAACAGCTAGAAAATGG - Intergenic
1182380350 22:29882959-29882981 ATGGCTAGACAGATGGGAAATGG - Intergenic
1183010776 22:34944733-34944755 AGGGTTGTACAGCTAGGAAAAGG + Intergenic
950041841 3:9924642-9924664 AAGGTTACACAGCTAGCAAATGG - Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951095589 3:18625891-18625913 CTAGACTAACAGCTAGGAAAGGG + Intergenic
951365661 3:21778984-21779006 ATGGAGAACCAGGTTGGAAAAGG + Intronic
951546098 3:23827032-23827054 ACTAATAAACAGCTAAGAAAAGG + Intronic
951634982 3:24763848-24763870 AGGGAAAAAGAGCTGGGAAAGGG + Intergenic
952053447 3:29414508-29414530 ATGGATAAATAGCAAGAAAATGG - Intronic
952393296 3:32899378-32899400 CTGGATAAACAGCCATAAAAAGG + Intergenic
953568898 3:44056436-44056458 ATGGATAAATAGCAGGGAATGGG + Intergenic
953600822 3:44362580-44362602 ATGGAGAAACTGCCAAGAAAAGG - Intronic
955345576 3:58159007-58159029 CTAGATATATAGCTAGGAAATGG + Intronic
956647713 3:71473231-71473253 AGGTACATACAGCTAGGAAATGG + Intronic
957060140 3:75474967-75474989 ATGATTAAACACCAAGGAAAGGG + Intergenic
957338009 3:78857749-78857771 AAGGATACACATCTAGGAATTGG + Intronic
957391300 3:79574350-79574372 TTGGAATAAAAGCTAGGAAAAGG - Intronic
957931893 3:86890064-86890086 AAGGATGAACAGGTAGTAAATGG - Intergenic
958184534 3:90103733-90103755 AGGGTTAAAAAGTTAGGAAAAGG - Intergenic
959565392 3:107827565-107827587 AAGGTCACACAGCTAGGAAATGG - Intergenic
959902925 3:111680099-111680121 AGGGCAAAACTGCTAGGAAAAGG - Intronic
960022119 3:112966568-112966590 ATGGATAAACCTTTAGGAAAAGG + Intronic
960549543 3:118959395-118959417 AAGAATAAACAGCAAGGAAGTGG + Intronic
961415735 3:126755247-126755269 AGGGATCAACAGCTGGGAATGGG + Intronic
961620414 3:128219496-128219518 ATGGGGAAACAGCAAGGAGAAGG - Intronic
961809773 3:129515066-129515088 ATGGAGACAGAGCTAGGAGAGGG - Intronic
963026802 3:140927756-140927778 TTGGGTGAACAGGTAGGAAATGG - Intergenic
963324907 3:143851895-143851917 AGGGATAAATAGCAAGGGAAAGG - Intergenic
964598626 3:158468543-158468565 AAGGATATAAAGCTAGTAAATGG - Intronic
965870964 3:173264904-173264926 ATGGTAAAACAGCTAGTAAGTGG - Intergenic
967042902 3:185710230-185710252 ATGTAATAGCAGCTAGGAAATGG + Intronic
967043064 3:185711695-185711717 AAGGAAAAAGAGGTAGGAAAAGG - Intronic
967266366 3:187695701-187695723 ATGCATCCACAGCTAGGCAATGG + Intergenic
967429783 3:189368774-189368796 TTGCATAAAAACCTAGGAAAAGG + Intergenic
969939915 4:10721887-10721909 ATGAATAAACAGCCAGGCAGTGG + Intergenic
970134840 4:12911312-12911334 AAGGATACACAGCTAGTAGATGG + Intergenic
970168759 4:13267312-13267334 ATAAATAAACAGCTTGGAGAAGG - Intergenic
970411883 4:15816854-15816876 AGGGATACAGAGATAGGAAAGGG + Intronic
970919760 4:21380122-21380144 ATTGATAAAGAAGTAGGAAAAGG + Intronic
971570141 4:28201637-28201659 ATTGATAAACAAATAGGACAAGG - Intergenic
972488959 4:39568437-39568459 ATGGAATAACACCTATGAAAAGG + Intronic
972920893 4:43940052-43940074 ATGAATAAATAGATAGGTAATGG - Intergenic
973948363 4:55984420-55984442 ATGAATATTCTGCTAGGAAAAGG - Intronic
975358997 4:73444646-73444668 AAGGATAAACAATTAAGAAATGG - Intronic
976050560 4:81007835-81007857 AAAGATATCCAGCTAGGAAATGG + Intergenic
976133807 4:81913321-81913343 AGGGTCATACAGCTAGGAAAAGG - Intronic
976657965 4:87509356-87509378 AGGGTTACACAGCTAGGAAGTGG + Intronic
976796169 4:88935504-88935526 ATGAATATAAAGATAGGAAATGG - Intronic
976820139 4:89197021-89197043 ATGAATAAGCAACTTGGAAAAGG - Intergenic
977287721 4:95129892-95129914 ATGGTGAAACAGATTGGAAAAGG + Exonic
978361788 4:107938616-107938638 ATGAACAAACAGGAAGGAAAGGG - Intronic
978885347 4:113761406-113761428 ATGGAAAAACAGCCAGGCACGGG + Intronic
978937721 4:114398632-114398654 AGTGATAAACAGCTGGGAAAGGG + Intergenic
980341579 4:131555420-131555442 ATGTATTAATAACTAGGAAAAGG + Intergenic
980834059 4:138168452-138168474 ATGAATATACTGCTAAGAAAGGG - Exonic
982162249 4:152581833-152581855 ATGAAGAAGCAGTTAGGAAACGG + Intergenic
984043092 4:174761881-174761903 TTGAATAAAAAGTTAGGAAAAGG + Intronic
984316353 4:178137185-178137207 CTGGATACACAGCTTGGAATGGG + Intergenic
984450315 4:179892388-179892410 ATGGAAATACAGCTAGAAAATGG + Intergenic
986247449 5:6023242-6023264 ATGGAGAAGCAGCAGGGAAAAGG + Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
990112329 5:52342552-52342574 ATGTTTACACAGCTAGGAAGTGG + Intergenic
990388235 5:55290102-55290124 ATGTATAAACTGTTAGAAAAGGG + Intronic
991468004 5:66935447-66935469 AGGGATAACCAGGTTGGAAAAGG - Intronic
992191969 5:74301518-74301540 TTGGATAAATACCTAGGAATGGG - Intergenic
992531220 5:77653418-77653440 AGGGATAAGCGGCTAGGAAAGGG + Intergenic
993143279 5:84061581-84061603 AAGGCTACACAGCTGGGAAATGG - Intronic
993930087 5:93927239-93927261 TTGGAAAAAGAACTAGGAAAGGG + Intronic
993952448 5:94193463-94193485 AAGGTTACACAGCTAGCAAATGG + Intronic
993988103 5:94621301-94621323 AAGGGTACACAGCTAGTAAATGG - Intronic
995925007 5:117361979-117362001 AAGGTTAAACAGCTAGTAAGTGG - Intergenic
996631264 5:125635693-125635715 ATGGATAAACTGTTAGACAATGG + Intergenic
996885264 5:128346360-128346382 ATGGATAATGAGTTTGGAAACGG + Intronic
997833755 5:137175597-137175619 AAGGTTAAAAAGCTAGTAAATGG - Intronic
997836538 5:137198437-137198459 CTGGATAAACAGCTATCAAAGGG + Intronic
999631387 5:153575292-153575314 AGGGTTAAACAGGTAGGCAATGG - Intronic
999744920 5:154584644-154584666 GTGCACAAACAGCTAGGAAGAGG - Intergenic
1000874615 5:166620463-166620485 ATGGATAAATATATAGGTAAAGG + Intergenic
1001688633 5:173615762-173615784 AGGAATAAACAGCTATAAAATGG + Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003359665 6:5412598-5412620 ATGGATAAAAAAATATGAAAAGG - Intronic
1003609052 6:7591801-7591823 AAGGATACACTGCTAGTAAATGG + Intronic
1003842627 6:10137806-10137828 TTGTATAAATAGCTTGGAAACGG - Intronic
1004466797 6:15892852-15892874 ATGGATAAAGTGCTAGGAACAGG - Intergenic
1004669062 6:17778593-17778615 ATGGTTACACAGCTAGGAAGTGG - Intronic
1004979686 6:21009492-21009514 TTGGATAAACAGCTAGTAGTGGG - Intronic
1005017659 6:21389582-21389604 ATAAATAAACATCTAGGAATGGG + Intergenic
1005309794 6:24548477-24548499 AGGGAGAATCAGCTGGGAAAGGG + Intronic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1006231102 6:32587512-32587534 ATGTATAGAAAGCAAGGAAATGG - Intronic
1006700175 6:35966066-35966088 AGGAATGGACAGCTAGGAAAGGG - Intronic
1006807437 6:36797817-36797839 AAGGACACACAGCTAGGAAGAGG - Intronic
1009523289 6:64711940-64711962 GTGGAGAAACAATTAGGAAAGGG + Intronic
1010808432 6:80267045-80267067 AAAGATAAACAGCTTAGAAAAGG - Intronic
1011411123 6:87067633-87067655 AATGATACTCAGCTAGGAAATGG + Intergenic
1012022290 6:93939148-93939170 ATGAATAAACATGTAGCAAATGG + Intergenic
1012219477 6:96630982-96631004 ATGGGGAAAGAGCTAAGAAATGG - Intergenic
1012417468 6:99025678-99025700 CTGGCTACACAGCTTGGAAAAGG - Intergenic
1012442556 6:99274976-99274998 GTGGCTAAACAGATAGCAAAGGG - Exonic
1014722747 6:124938125-124938147 ATAGATAAAAAGGTAGGATATGG - Intergenic
1016090892 6:139977576-139977598 AAGGACATTCAGCTAGGAAAGGG - Intergenic
1016329121 6:142937570-142937592 ATGGATAAACAGGTAGCCCACGG - Intronic
1017588513 6:155953206-155953228 TTGGAGAAACAATTAGGAAAAGG + Intergenic
1019035500 6:169053262-169053284 ATGGATAAAATGCTATTAAATGG - Intergenic
1019049018 6:169169256-169169278 ATGGATAAAGTACGAGGAAAGGG + Intergenic
1020360029 7:7318278-7318300 ATGGAGACACAGATAGGATAAGG + Intergenic
1020518551 7:9156720-9156742 ATGGATATACAGATAGGAGGTGG - Intergenic
1021054916 7:16035638-16035660 ATGGATTAAAAGCCAGGTAAAGG - Intergenic
1021790863 7:24204162-24204184 ATGGACAAACTGCTAGTAATGGG + Intergenic
1022167248 7:27780354-27780376 AAGGTTACACAGCTAGTAAATGG - Intronic
1022611942 7:31884672-31884694 ATGGATAAAGAGCTAGAGAAAGG - Intronic
1022640687 7:32179731-32179753 CTTGATAAACTGCTAGTAAAAGG + Intronic
1022759798 7:33335740-33335762 ATAGAGAAAGAGCTAGTAAATGG + Intronic
1022906004 7:34857923-34857945 ATGGACAAAAAACTATGAAAAGG + Intronic
1023087078 7:36581503-36581525 TTGGAAAAACAGATGGGAAATGG + Intronic
1023835373 7:44064540-44064562 AGGGACACCCAGCTAGGAAACGG - Intronic
1024396987 7:48880851-48880873 AGGGAAAAACAGGTAGGAAAGGG - Intergenic
1026022033 7:66715994-66716016 ATAGAAAATCAGCTAGGATATGG - Intronic
1027660578 7:80983595-80983617 AAGGATAAACACATAGAAAAGGG + Intergenic
1028453948 7:91018233-91018255 GAGGACAAACAGCTAGTAAATGG - Intronic
1028576107 7:92352933-92352955 AGGGGTATACAGCTAGGAATTGG + Intronic
1028888403 7:95960003-95960025 AAGGATAAAAAACTAGGCAAAGG + Intronic
1029028786 7:97447014-97447036 ATGCTTACACAGCTAGGAAATGG + Intergenic
1030459102 7:109808367-109808389 CTGGAAAAGCAGCCAGGAAAGGG + Intergenic
1030539463 7:110811803-110811825 ATGGACTAACAACTAGGGAAGGG - Intronic
1031528785 7:122852018-122852040 ATGGTCAAACAGCTAGTAAGCGG + Intronic
1031557150 7:123191493-123191515 ATGGAGAAAGAGCTTGGGAAGGG + Intronic
1031720370 7:125167937-125167959 ACGGATAGACAGCTAGGAGTGGG + Intergenic
1032070173 7:128800091-128800113 ATGGACAAACATATAGAAAAAGG - Intronic
1032502462 7:132410152-132410174 TTGGGCAAACAGGTAGGAAAGGG + Intronic
1033251838 7:139767422-139767444 AAGAATAAACAGGTAGGTAAGGG + Intronic
1034658796 7:152751130-152751152 ATGAATATATAGCTCGGAAAGGG + Intergenic
1034918858 7:155062369-155062391 CTGGAGAAAGAGCTAGGGAAGGG + Intergenic
1035928326 8:3753825-3753847 TTGGATAAATAGCTTGAAAATGG - Intronic
1039200936 8:35093240-35093262 ATGGATAAACTGAAAGGAACAGG + Intergenic
1039593085 8:38767248-38767270 ATGGATACACAGGTGTGAAAAGG - Intronic
1040005255 8:42615396-42615418 ACAGATAAATAGCTGGGAAAGGG - Intergenic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1040582803 8:48711118-48711140 AAGGATAGACAGCTGGGACATGG - Intronic
1040949199 8:52919172-52919194 ATAAATAAACAGCTTGGAAGAGG + Intergenic
1042082869 8:65074987-65075009 ATGAATAAACAGAAAAGAAAAGG + Intergenic
1043375775 8:79647715-79647737 ATGGAGAAAAAGCAGGGAAAGGG - Intronic
1043469956 8:80552352-80552374 TTGGGTAAACAGCTAAGAACAGG - Intergenic
1043552450 8:81390018-81390040 ATGGGTAAACAACAAGGAATTGG + Intergenic
1043967618 8:86496444-86496466 ATGGAGAAACATCAAGCAAATGG + Intronic
1044253558 8:90032865-90032887 ATTAATACACAGCTAGTAAATGG + Intronic
1044418930 8:91968775-91968797 AAAGTTACACAGCTAGGAAATGG - Intronic
1044562871 8:93630514-93630536 ATGAACAAACATCTAGAAAAAGG + Intergenic
1045656447 8:104392028-104392050 AAGGCAACACAGCTAGGAAATGG + Intronic
1045716422 8:105051796-105051818 ATGTATAAACTGCTTGGAGAGGG - Intronic
1047889640 8:129293704-129293726 ATGGATAAAAAGCTGGGGTAGGG + Intergenic
1048716848 8:137280705-137280727 ATGGATAAATAAATAGGTAAAGG - Intergenic
1048817840 8:138350695-138350717 ATAGATAAACAGCTGGGAGGTGG - Intronic
1049060879 8:140275194-140275216 AAGGACAAATAGCTAGTAAATGG + Intronic
1050950007 9:11577494-11577516 ATAGATAAACAGCTATTAATAGG + Intergenic
1051077503 9:13257367-13257389 AAGGTCAAACAGCTAGTAAATGG + Intronic
1051741598 9:20257921-20257943 GTGTGTAAACAGCTAAGAAAAGG + Intergenic
1053277107 9:36791387-36791409 TTGGAAAAACAGCTTGGAAGGGG - Intergenic
1053437798 9:38088364-38088386 ATTGATAAACATCTAAGAATAGG + Intergenic
1053729844 9:41042317-41042339 TTGGGTAAACAGCTAGGAATGGG - Intergenic
1054698663 9:68389746-68389768 TTGGGTAAACAGCTAGGAATGGG + Intronic
1054924071 9:70571231-70571253 AAGGTTACACAGCTAGTAAACGG - Intronic
1055417758 9:76102236-76102258 AAGGACAAACAGCTACAAAAGGG - Intronic
1056290822 9:85142201-85142223 ATGGAGACACAGCTAGGAAGTGG - Intergenic
1056345211 9:85687200-85687222 ATGTATACACAGCTAAGAACAGG + Intronic
1056704210 9:88938088-88938110 ATGGAGGAACAGCCATGAAAAGG + Intergenic
1058349642 9:104006726-104006748 AGGGATACACAGAGAGGAAAAGG + Intergenic
1059213214 9:112534053-112534075 AAGGTTACAGAGCTAGGAAATGG - Intronic
1059250459 9:112883405-112883427 AAGGGTACACAGCTAGGAAGTGG - Intronic
1059433174 9:114261806-114261828 ATGGTCACACAGCTAGGAAATGG - Intronic
1059578011 9:115512793-115512815 ATGGCTAAATATCCAGGAAAGGG - Intergenic
1061220452 9:129247470-129247492 AAGGTTCAACAGCTAGGAAGTGG - Intergenic
1186168766 X:6855487-6855509 ATGGATAAACATCTAAGACAGGG - Intergenic
1186771532 X:12822762-12822784 ATGGCTGAACAGGTAGGACACGG - Exonic
1187243102 X:17531196-17531218 TTGGATTCACAGCTAGGAAATGG - Intronic
1187287775 X:17922646-17922668 ATGTATACACATCCAGGAAATGG - Intergenic
1189645092 X:43119624-43119646 ATGGTTATACAGCCAGTAAAAGG - Intergenic
1189692760 X:43634301-43634323 ATGGGGAGATAGCTAGGAAAAGG + Intergenic
1189830796 X:44971224-44971246 ATGCATGAAGAACTAGGAAATGG + Intronic
1189887204 X:45559787-45559809 ATGGAAAAACATTTATGAAATGG - Intergenic
1190289392 X:48982250-48982272 AAGGTCACACAGCTAGGAAATGG + Intronic
1190536846 X:51437462-51437484 ATGGATAGAGAGGTAGGAGATGG + Intergenic
1191139934 X:57105972-57105994 CTGGAAAAACAGATAGCAAAGGG + Intergenic
1192205915 X:69095957-69095979 ATGGTTACACAGCTAGTAAGCGG + Intergenic
1192348087 X:70328946-70328968 AAGGTCAAACAGCTAGTAAATGG - Intronic
1192743205 X:73913412-73913434 ATCCATTAACAGCCAGGAAATGG + Intergenic
1193220789 X:78923921-78923943 ATGAATCAGCAGCTGGGAAATGG - Intergenic
1193236008 X:79108463-79108485 ATGGGTAAAAAGCAAGGAGAAGG - Intergenic
1194427723 X:93760660-93760682 ATGGATGAAGAACTAGGAAATGG - Intergenic
1196032778 X:111109031-111109053 AAGGTTACACAGCTAGGAAGTGG - Intronic
1196794564 X:119491728-119491750 GGAGATAAACAGCTAGCAAATGG - Intergenic
1197031042 X:121816411-121816433 TTGGATATACAGCTAGTAATGGG + Intergenic
1197144372 X:123155079-123155101 ATGGTTACACAGCTAGTAATTGG + Intergenic
1197484381 X:127029622-127029644 AAGGTAACACAGCTAGGAAAGGG - Intergenic
1197652504 X:129081107-129081129 ATGGTCACACAGCTAGTAAATGG + Intergenic
1198010190 X:132544671-132544693 ATGGACGATCAGGTAGGAAAGGG + Intergenic
1198151718 X:133916976-133916998 ATGGACATAATGCTAGGAAATGG - Intronic
1198665631 X:139019159-139019181 ATGGATACACAGGTAGAAAGTGG + Intronic
1198672533 X:139096360-139096382 AAGGATAAAGATATAGGAAAGGG + Intronic
1199118369 X:144019797-144019819 AGAGATAAACAGCTTGGTAAGGG - Intergenic
1201559167 Y:15297907-15297929 ATGGATAAACATCTATCACAGGG - Intergenic
1201850167 Y:18471591-18471613 TTGGATTAACAGCTAGGAACAGG - Intergenic
1201883151 Y:18848786-18848808 TTGGATTAACAGCTAGGAACAGG + Intergenic
1202349568 Y:23973327-23973349 TTGGATTAACAGCTAGGAATTGG + Intergenic
1202521207 Y:25696777-25696799 TTGGATTAACAGCTAGGAATTGG - Intergenic