ID: 916811150 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:168306906-168306928 |
| Sequence | AGGAGCAAAGGCTGCCCAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 345 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 47, 4: 295} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 916811143_916811150 | 20 | Left | 916811143 | 1:168306863-168306885 | CCATGTGAATGAAGGAAAAAGAG | 0: 1 1: 0 2: 1 3: 55 4: 573 |
||
| Right | 916811150 | 1:168306906-168306928 | AGGAGCAAAGGCTGCCCAGAGGG | 0: 1 1: 0 2: 2 3: 47 4: 295 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 916811150 | Original CRISPR | AGGAGCAAAGGCTGCCCAGA GGG | Intronic | ||