ID: 916811150

View in Genome Browser
Species Human (GRCh38)
Location 1:168306906-168306928
Sequence AGGAGCAAAGGCTGCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916811143_916811150 20 Left 916811143 1:168306863-168306885 CCATGTGAATGAAGGAAAAAGAG 0: 1
1: 0
2: 1
3: 55
4: 573
Right 916811150 1:168306906-168306928 AGGAGCAAAGGCTGCCCAGAGGG 0: 1
1: 0
2: 2
3: 47
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916811150 Original CRISPR AGGAGCAAAGGCTGCCCAGA GGG Intronic