ID: 916812080

View in Genome Browser
Species Human (GRCh38)
Location 1:168314503-168314525
Sequence GACACATAGGTGCATCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916812080 Original CRISPR GACACATAGGTGCATCCGTG TGG Intergenic
905270430 1:36783950-36783972 GACAGATAGGTGTAGCTGTGTGG - Intergenic
905309790 1:37041363-37041385 GACACAGAGGTGCTTGGGTGTGG - Intergenic
905784049 1:40738305-40738327 GGCACAAAGGTGCATGCCTGTGG - Intronic
906036824 1:42755716-42755738 GTCACATGGGAGCATCAGTGTGG - Intronic
908886378 1:68793890-68793912 GACACATCTGTACATCTGTGGGG - Intergenic
916812080 1:168314503-168314525 GACACATAGGTGCATCCGTGTGG + Intergenic
918638815 1:186813332-186813354 CCCACATAGGTACATACGTGTGG - Intergenic
922540447 1:226414896-226414918 GCCACATAGGGGCTGCCGTGGGG - Intergenic
1062939585 10:1411255-1411277 GAGGCACAGGTGCGTCCGTGAGG + Intronic
1066455878 10:35571591-35571613 GACACATAGGTAGATACTTGAGG + Exonic
1072292164 10:93974210-93974232 GCCACATTGGTGTATCCCTGTGG + Intergenic
1076194808 10:128509991-128510013 GACACATGTGTGCGTCAGTGTGG - Intergenic
1088805935 11:113351932-113351954 GTCACACAGGGGCATCCCTGGGG - Intronic
1091157460 11:133386863-133386885 GACACTTAGGGGTGTCCGTGAGG + Intronic
1093066938 12:14668141-14668163 GACATAGAGGTGCATACCTGTGG - Intronic
1094817875 12:34204899-34204921 CACACATGGGTGCACGCGTGCGG - Intergenic
1116430925 14:44844281-44844303 GATGCATAGGTGCATAGGTGCGG - Intergenic
1121011452 14:90522551-90522573 GACATGTAGGGGCATCTGTGAGG + Intergenic
1122389579 14:101371070-101371092 AACACATAGCTGCCTCTGTGTGG + Intergenic
1126631321 15:50738854-50738876 GACACACAGGTACTTCCCTGTGG - Intronic
1126925198 15:53577628-53577650 CATATATAGATGCATCCGTGAGG - Intronic
1138077974 16:54061637-54061659 GAAACACAAGTGCATGCGTGCGG - Intronic
1147235562 17:39055024-39055046 GCCTCATAGGGGCACCCGTGTGG - Intergenic
1154313432 18:13284901-13284923 GTCACATCAGTGCATCTGTGAGG + Intronic
1154345994 18:13543989-13544011 CCCACATACGTGCATACGTGTGG + Intronic
1160846399 19:1168022-1168044 GCCACACAGGTGCACCCCTGGGG + Intronic
1161845169 19:6707986-6708008 GATACACAGGTGCATATGTGGGG - Intronic
1162034596 19:7932224-7932246 GACCCAGAGCTGCAGCCGTGAGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
927166559 2:20329029-20329051 GGCACATTGGTGCATGCCTGTGG + Intronic
1174094775 20:48079352-48079374 GGCAGAGAGGTGCATCCATGAGG + Intergenic
1175169743 20:57071884-57071906 GACACACAGGTGAATCCTAGTGG + Intergenic
1176868489 21:14070086-14070108 CACACATGGGTGCATGCGCGCGG - Intergenic
1181801848 22:25352858-25352880 GACAAAAGGGTGCATCCATGGGG - Intronic
1184360840 22:44017702-44017724 GACACAGAGATGCATCTGTGGGG - Intronic
1184722880 22:46325633-46325655 GGCACATTGGTGCATACCTGTGG - Intronic
952286352 3:31973161-31973183 GACACAAAGGCCCATCCATGTGG + Intronic
954700543 3:52448597-52448619 GAGACACAGGTTCAGCCGTGGGG - Intergenic
961389656 3:126544808-126544830 TACACATGGGGGCATCAGTGGGG - Intronic
965465288 3:169022381-169022403 AACACATAAATGCATGCGTGTGG + Intergenic
967143507 3:186585163-186585185 GACACACATGTGCATGTGTGGGG + Intronic
971238405 4:24864788-24864810 CACACATAAGTGGATCTGTGTGG - Intronic
972219984 4:36943846-36943868 GACACATAGATGCATACATAGGG + Intergenic
978127674 4:105154006-105154028 GTCACATAGGTGAATCTGAGAGG + Intronic
985419677 4:189772153-189772175 CTCACACAGGTGCATCTGTGTGG - Intergenic
990033329 5:51289087-51289109 GTCACATCAGTGCATCAGTGTGG - Intergenic
997852025 5:137341438-137341460 GAGACATGACTGCATCCGTGAGG - Intronic
1002656210 5:180749804-180749826 CAAACATAGGTGCATATGTGTGG + Intergenic
1005698552 6:28376068-28376090 GACACAGAGGTGAATTCCTGTGG - Intergenic
1005728441 6:28672255-28672277 GACAGATAGCTTCATCCTTGAGG + Intergenic
1005806409 6:29477899-29477921 CACATATTGGTGCATCAGTGGGG + Intergenic
1009648343 6:66439044-66439066 GACAGAAAGGTGCATCTGAGTGG + Intergenic
1017999875 6:159569643-159569665 GACACATAGGTGAATCCTGGGGG + Intergenic
1019287665 7:231674-231696 GGCACAGAGGAGCATCTGTGAGG + Intronic
1029006586 7:97216285-97216307 GAAACATCGTTGCATCCCTGGGG + Intergenic
1030324533 7:108205223-108205245 GACACATAGCAGCATCTGTGAGG + Intronic
1031120185 7:117713348-117713370 GACATATAGGTGAATTAGTGGGG - Intronic
1035612961 8:980614-980636 GACACAGAGGTGAATCCAGGTGG + Intergenic
1036836250 8:12071085-12071107 GACTCATAGTTGCATCCTTAGGG - Intronic
1036858092 8:12317654-12317676 GACTCATAGTTGCATCCTTAGGG - Intergenic
1038848371 8:31250941-31250963 CACACATAGGTGCATCAGAGTGG - Intergenic
1039554132 8:38465097-38465119 GATACATCGGTGCATCCCTCAGG - Intronic
1052974269 9:34400229-34400251 GACAGATAGATGCATTGGTGAGG + Exonic
1056074541 9:83024957-83024979 GACAGCAAGGAGCATCCGTGTGG + Intronic
1061221844 9:129256666-129256688 GACCCACAGGTGCATGCCTGTGG - Intergenic
1185941861 X:4330846-4330868 TACACATATGTGCATGTGTGTGG - Intergenic
1189454538 X:41173841-41173863 TACACATAGCTTCATTCGTGTGG - Intronic
1194643911 X:96434891-96434913 GACAGATAGGAGCACCTGTGTGG + Intergenic