ID: 916813135

View in Genome Browser
Species Human (GRCh38)
Location 1:168323792-168323814
Sequence CATCTGTAGGAGAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916813135_916813142 15 Left 916813135 1:168323792-168323814 CCTCCCAGCCTCTCCTACAGATG No data
Right 916813142 1:168323830-168323852 TGCCTTTTCCTGCCTTATGGTGG No data
916813135_916813144 22 Left 916813135 1:168323792-168323814 CCTCCCAGCCTCTCCTACAGATG No data
Right 916813144 1:168323837-168323859 TCCTGCCTTATGGTGGCTGCTGG No data
916813135_916813141 12 Left 916813135 1:168323792-168323814 CCTCCCAGCCTCTCCTACAGATG No data
Right 916813141 1:168323827-168323849 CCATGCCTTTTCCTGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916813135 Original CRISPR CATCTGTAGGAGAGGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr