ID: 916813943

View in Genome Browser
Species Human (GRCh38)
Location 1:168332545-168332567
Sequence CTGTGCTTTTCTAGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916813932_916813943 11 Left 916813932 1:168332511-168332533 CCAATCTCATGTATGATGACTAG No data
Right 916813943 1:168332545-168332567 CTGTGCTTTTCTAGGGAAATGGG No data
916813931_916813943 30 Left 916813931 1:168332492-168332514 CCATCATCTGAAACTCTAGCCAA No data
Right 916813943 1:168332545-168332567 CTGTGCTTTTCTAGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916813943 Original CRISPR CTGTGCTTTTCTAGGGAAAT GGG Intergenic
No off target data available for this crispr