ID: 916824138

View in Genome Browser
Species Human (GRCh38)
Location 1:168428214-168428236
Sequence CAGAAAAAGGAAAAGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916824135_916824138 0 Left 916824135 1:168428191-168428213 CCAAATACATTGCTGTACTATAT No data
Right 916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG No data
916824133_916824138 29 Left 916824133 1:168428162-168428184 CCAGAATTATTTTTAGAATGCAA No data
Right 916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916824138 Original CRISPR CAGAAAAAGGAAAAGTGGAG AGG Intergenic
No off target data available for this crispr