ID: 916835598

View in Genome Browser
Species Human (GRCh38)
Location 1:168541804-168541826
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 29}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916835593_916835598 30 Left 916835593 1:168541751-168541773 CCACTAAGACAAATAGAGGAGGA 0: 1
1: 0
2: 2
3: 15
4: 173
Right 916835598 1:168541804-168541826 TGCAATAATCGCTATTCGGTTGG 0: 2
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916835598 1:168541804-168541826 TGCAATAATCGCTATTCGGTTGG + Intronic
916839006 1:168580344-168580366 TGCAATAATCGCTATTCGGTTGG - Intronic
921426590 1:215009165-215009187 TGCAAAAATCAGTATTAGGTGGG + Intronic
1070242413 10:74696140-74696162 TGCAATCCTAGCTATTCGGTTGG - Intronic
1092079064 12:5698286-5698308 TGCAATATTCGCTGTTCTGCAGG + Intronic
1097740239 12:63233513-63233535 TGTAATCATAGCTATTCGGGAGG - Intergenic
1099445164 12:82743317-82743339 TGTAATCATAGCTACTCGGTAGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1117032663 14:51690278-51690300 GGTAATCATCGCTATTAGGTTGG + Intronic
1138662906 16:58535613-58535635 TGCAGTAATAGCTTTTCAGTAGG + Intronic
1140983573 16:80136142-80136164 TGCAATCAACCCTATTGGGTCGG + Intergenic
1157096254 18:44687911-44687933 TTCAATAATAGCTAATGGGTTGG + Intronic
927788366 2:25990221-25990243 TGCAATACCAGCTATTCGGGAGG + Intergenic
929428366 2:41866758-41866780 TGCAATAATAGCAATTCAGTAGG - Intergenic
941660517 2:168191573-168191595 TGCAATAATTGTGATTCAGTAGG - Intronic
941683222 2:168421324-168421346 TGGAATAATCGCCATTTGGTGGG + Intergenic
1171075851 20:22122420-22122442 TACAATGATAGCTATTAGGTTGG - Intergenic
955498201 3:59558480-59558502 TGAAATAATAGCTACTCAGTTGG - Intergenic
976977215 4:91180111-91180133 TGCAATATTCGCTGTTCTGCAGG - Intronic
981165853 4:141556158-141556180 TGCAATCCCAGCTATTCGGTAGG - Intergenic
990973649 5:61537693-61537715 GGCAATAATTGCTCTTGGGTGGG + Intronic
994835987 5:104853126-104853148 TGTAATAACAGCTACTCGGTAGG - Intergenic
1008289148 6:49691995-49692017 TGGAATAATCAATATTAGGTTGG - Intergenic
1011504352 6:88024765-88024787 GGCAACAATCCCTATTCAGTGGG + Intergenic
1015929803 6:138347878-138347900 AGCAATAAAAGCTATTAGGTTGG - Intergenic
1017168239 6:151430411-151430433 TACAATAATGGCTATTTGTTTGG - Intronic
1024124446 7:46278173-46278195 AGCAATAATAGCTATTTGTTAGG + Intergenic
1033158049 7:138972941-138972963 TGCAATCCTAGCTATTCGGGGGG - Intronic
1034735099 7:153421571-153421593 TGCAATCCTAGCTACTCGGTAGG + Intergenic
1041471228 8:58211751-58211773 TGCAAAATTCGGTATTTGGTGGG - Intergenic
1050396816 9:5206941-5206963 TGTAATCATCGCTATTCAGGAGG + Intergenic
1050524335 9:6532361-6532383 TGTAACAATGGCTATTGGGTTGG + Intergenic
1187965782 X:24609969-24609991 TGCAATACTAGCTACTCGGGAGG + Intronic
1198079304 X:133223913-133223935 TGCAGTCCTAGCTATTCGGTAGG + Intergenic