ID: 916837589

View in Genome Browser
Species Human (GRCh38)
Location 1:168563918-168563940
Sequence CAGAACAATGAGAAATAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916837586_916837589 -7 Left 916837586 1:168563902-168563924 CCAAAAGCAAATGCAACAGAACA 0: 2
1: 29
2: 201
3: 1641
4: 8321
Right 916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG No data
916837585_916837589 -6 Left 916837585 1:168563901-168563923 CCCAAAAGCAAATGCAACAGAAC 0: 2
1: 82
2: 979
3: 1671
4: 1981
Right 916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916837589 Original CRISPR CAGAACAATGAGAAATAGGC GGG Intergenic
No off target data available for this crispr