ID: 916839246

View in Genome Browser
Species Human (GRCh38)
Location 1:168583232-168583254
Sequence CAGTGTAATATGTGGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916839246 Original CRISPR CAGTGTAATATGTGGGATGA TGG Intergenic
901436731 1:9251141-9251163 CAGGGTCATCTCTGGGATGAAGG - Intronic
907398212 1:54207171-54207193 CAGTGTAATCTGTGCTATGATGG - Intronic
908065684 1:60401579-60401601 CTGTGCAATATATGGGATGGTGG - Intergenic
910850359 1:91644193-91644215 CACTGTAAAATTTGGGATTATGG + Intergenic
912715271 1:111979114-111979136 CATTGTCAGATGTGGGGTGAGGG + Intronic
915795471 1:158728482-158728504 CAGTGAAATATGAGAGAGGAAGG + Intergenic
916286696 1:163113389-163113411 CAGTGTCATCAGTGGGCTGAGGG - Intronic
916744755 1:167676605-167676627 CAGTGTAATTTGGGAGATGATGG - Intronic
916839246 1:168583232-168583254 CAGTGTAATATGTGGGATGATGG + Intergenic
917119053 1:171629824-171629846 CAGGGACATTTGTGGGATGAAGG + Intergenic
918245081 1:182652008-182652030 CAGTGGAAAATGTGGTAAGATGG - Intronic
919422149 1:197383163-197383185 CAGGGATATGTGTGGGATGAAGG - Intronic
922789410 1:228302838-228302860 CAGGGTAATATGTGGGAATGTGG + Intronic
922953944 1:229583381-229583403 CAGTGTTCCATGTGGGAAGAAGG - Intergenic
923854293 1:237829156-237829178 CAGTTTAATATGTGGGCTGTGGG + Intronic
924700737 1:246449463-246449485 CAGTGTGATATGGGGCAGGAGGG + Intronic
924921053 1:248629485-248629507 CAGGGTAAAATGTGTCATGATGG - Intergenic
1062909257 10:1201927-1201949 CTGTGGAATCTGTGGAATGAAGG - Intronic
1064109929 10:12529886-12529908 CAGTGTAATATGGGGAAAAAGGG - Intronic
1068239036 10:54280021-54280043 ATGTGTAATATATGGTATGATGG - Intronic
1073258820 10:102173335-102173357 CAGTGTGGTATGTTGGAAGATGG - Intergenic
1073532423 10:104244821-104244843 CAATGTGAAATGTGGAATGATGG - Intronic
1074185123 10:111094448-111094470 CAGGGTCATGTGTGGGATGGAGG + Intergenic
1076168332 10:128300097-128300119 CACAGTAAAATGTGAGATGAGGG - Intergenic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1081558290 11:44187899-44187921 CAGTATAATAGATGGAATGATGG - Intronic
1086590198 11:88506564-88506586 CGGTGTAATATTTGGGATCAGGG + Intronic
1089706788 11:120283838-120283860 CAGTGGAATATTTGGGAAAAGGG + Intronic
1090016878 11:123094013-123094035 AAGTGTAATATGTGCTATGTAGG - Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1097535420 12:60863828-60863850 CAGGATAAGATGAGGGATGAAGG + Intergenic
1097891061 12:64778423-64778445 TACTGTAGTATGTGGGAAGAGGG + Intergenic
1099813300 12:87613619-87613641 GAGGGTAAAATGTGGGAGGAGGG - Intergenic
1101352767 12:103947771-103947793 CACTGTAAAATGTGGGATTATGG + Exonic
1101506530 12:105351942-105351964 CAGTGTGACACATGGGATGAGGG + Intronic
1104256598 12:127144839-127144861 CAGTGAAATATGTGCAAGGATGG + Intergenic
1108279159 13:48843713-48843735 AAGTGCAATATGTGGGCTCAGGG + Intergenic
1108536376 13:51384674-51384696 CAGTTAAATATGGAGGATGAGGG - Intronic
1108918623 13:55648766-55648788 CAGTATAATAGGTGGTATGCAGG - Intergenic
1109220981 13:59640610-59640632 TAATGTAATATGTAGAATGATGG - Intergenic
1109765273 13:66887245-66887267 CAGTATCATTAGTGGGATGATGG + Intronic
1110171967 13:72511954-72511976 CAGTTTAATATCTGTGATTATGG - Intergenic
1112914846 13:104535421-104535443 CAGCGTAGTATGTGTGATGGAGG + Intergenic
1114683471 14:24506501-24506523 AAGTGTTATATTTTGGATGACGG + Exonic
1116387043 14:44344557-44344579 AAGTGTACAATGTGGGAAGAAGG + Intergenic
1116836675 14:49775497-49775519 CATTGTATTTGGTGGGATGAGGG + Intronic
1120475526 14:84982213-84982235 GAGTGTAATATTTGAGATGTGGG - Intergenic
1120537984 14:85720939-85720961 AATAGTAATATTTGGGATGAAGG - Intergenic
1121751340 14:96359929-96359951 CAGTTTGATATGTGGCTTGAAGG - Intronic
1123826594 15:24088238-24088260 CCCTGTATTATGTTGGATGAAGG - Intergenic
1123855964 15:24411937-24411959 CCCTGTATTATGTTGGATGAAGG - Intergenic
1123860886 15:24465512-24465534 CCCTGTATTATGTTGGATGAAGG - Intergenic
1131445234 15:92493376-92493398 CAGTGCAACATGTGGCATGGAGG - Intronic
1131864385 15:96691760-96691782 CAATGGAATATATGAGATGATGG + Intergenic
1132129260 15:99260131-99260153 CACTGTAAAATGTGGGATTATGG + Intronic
1133984760 16:10660187-10660209 CACTGGAATAAGTGGGTTGAGGG - Intronic
1149280400 17:55098383-55098405 CAGTCTTATATATGGAATGAAGG + Intronic
1149943667 17:60898759-60898781 CAGTGTAACATGGGTGATAACGG + Intronic
1151079179 17:71308765-71308787 CAGTATAATATGTTGGCTGTGGG - Intergenic
1155691110 18:28623749-28623771 CAGTATAGTATTTGGCATGAAGG + Intergenic
1156016361 18:32551352-32551374 CACTGTAAAATGGGGGACGATGG + Intergenic
1158623895 18:59055574-59055596 TAGTGTAATATTTGGAAAGAAGG - Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1165722352 19:38088602-38088624 CTGTGCAATCTGTGGGATGCTGG - Intronic
1166948799 19:46413018-46413040 CAGGGTGATATCTGGGGTGAGGG + Exonic
1167984712 19:53304603-53304625 CAGTGCAAAATGTGGGTTCAGGG + Intergenic
928434433 2:31245083-31245105 CAGTGTAATAAGTGTGAGCAGGG - Intronic
932881088 2:75502934-75502956 CTATGTAATAGGTGGGGTGAGGG - Intronic
933498056 2:83076329-83076351 CAGTGAAATATGTGGGAAAATGG - Intergenic
933547512 2:83733732-83733754 CAATGTGATATATGGTATGATGG - Intergenic
939775699 2:146384996-146385018 CAGTCTATTATGTGGCAAGATGG + Intergenic
940790936 2:158029050-158029072 GAGTGCATTATGTGGAATGAGGG - Intronic
941544511 2:166831878-166831900 TACTGTACTATCTGGGATGATGG + Intergenic
942236053 2:173906159-173906181 CAGTGTGGTATGTTGGGTGATGG - Intergenic
943549948 2:189326292-189326314 AAGTTTAATTTGTAGGATGATGG + Intergenic
945041665 2:205747834-205747856 CAGTGTAATTTGGGGCATGTTGG - Intronic
948093393 2:235314541-235314563 CAGTGTCATTTGTGGGCTCATGG + Intergenic
1171105916 20:22432269-22432291 CAGTGTAATTTATGGAAAGATGG + Intergenic
1172463592 20:35138227-35138249 CATAGAAATATGTGGGATTAAGG - Intronic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174566089 20:51465499-51465521 GAGTGTTATAGGTGGGGTGAGGG - Intronic
1174676715 20:52364540-52364562 GTGTGTAATATAAGGGATGATGG + Intergenic
1176786779 21:13266294-13266316 CATTGTAGTATGTGTGATGGAGG - Intergenic
1183233827 22:36600959-36600981 CTGGGTACTATGTGAGATGATGG - Intronic
1184866566 22:47204878-47204900 CAGGGTTAGATGTGGGGTGACGG + Intergenic
1184866581 22:47204964-47204986 CAGGGTTAGATGTGGGGTGACGG + Intergenic
1184866590 22:47205005-47205027 CAGGGTTAGATGTGGGGTGACGG + Intergenic
950865763 3:16187978-16188000 CAGTGTCAGATGTGGGAACAAGG + Intronic
951327207 3:21316961-21316983 CAGTTTCATCTGTGGGATGGAGG - Intergenic
951763739 3:26173532-26173554 CAGTGTAATTTGTGAGATTTTGG + Intergenic
954671093 3:52291771-52291793 CAGTGTGACAGGTGGGATGGGGG - Exonic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
957141073 3:76358302-76358324 CACTTTAATATGTGGGAGAATGG - Intronic
957398653 3:79679083-79679105 AAGTGTAATTTGTGGGATTAAGG - Intronic
957438486 3:80211163-80211185 TCTTGTAATATGTGGAATGAAGG - Intergenic
959888980 3:111533113-111533135 CTGTGGAGTATGTGAGATGAAGG - Intronic
960053716 3:113261337-113261359 CAGAGAAATATGTGTGATGTGGG + Intronic
962681427 3:137804120-137804142 CTGTATAATAAGTGGGCTGATGG + Intergenic
965433868 3:168622341-168622363 CAGTTTAAATTGTAGGATGATGG + Intergenic
965925733 3:173977355-173977377 CACTGTAATGTGAGGGATCATGG + Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970756603 4:19434599-19434621 CAGGGTAAAATGAGGGGTGAGGG - Intergenic
971116226 4:23648616-23648638 CAGATAAATATGTGAGATGATGG - Intergenic
971142020 4:23934526-23934548 GATTGTAATCTGTGGAATGATGG + Intergenic
972298736 4:37765349-37765371 CAGTAGGATATGTGGGATGCAGG + Intergenic
972775461 4:42235773-42235795 CAGTGTAATATATGTAATGTGGG - Intergenic
974576946 4:63738160-63738182 CAGTGTAATTTGAGTGATAATGG + Intergenic
976626945 4:87195264-87195286 CAGTGTAATATGAGAAATGGGGG - Intronic
978311569 4:107390026-107390048 CTTTGTAAGATGTTGGATGATGG - Intergenic
982449801 4:155540224-155540246 TACTGAAATATGTGGGAAGAGGG - Intergenic
983478753 4:168247280-168247302 GTGTTTGATATGTGGGATGACGG - Intronic
984611767 4:181848460-181848482 CAGTGCAATATGAAGGATGATGG + Intergenic
985292525 4:188401222-188401244 CAGGGGAATCTGTGGGTTGAAGG - Intergenic
985404897 4:189628284-189628306 CACTGTGATATGCGCGATGAGGG - Intergenic
993996461 5:94729355-94729377 CAGTACAATATTTGGGATTATGG + Intronic
996267532 5:121560007-121560029 CAGTGCAATTTGTGGTAGGAAGG - Intergenic
998676567 5:144415282-144415304 CAGTGTTATATGTTGGGAGATGG - Intronic
999466193 5:151808058-151808080 CAATGTCTTATGTGGGATGAGGG + Exonic
1000980728 5:167813851-167813873 CATTGTAATATGTAGGATGGTGG - Intronic
1004788298 6:18994323-18994345 CACTGTAGTATGTGTTATGATGG + Intergenic
1005306569 6:24519831-24519853 CAGTGTAAGCTGTGGGTTGTGGG + Intronic
1009957420 6:70472462-70472484 CACTAAAATATTTGGGATGATGG - Intronic
1011046697 6:83092023-83092045 CAGTGACATATATGGAATGAAGG - Intronic
1012532092 6:100250446-100250468 CAGTGTAATAAATGCCATGAAGG + Intergenic
1015547143 6:134372799-134372821 CAGGGTAAAAAGTGGGCTGATGG + Intergenic
1016297562 6:142590390-142590412 CATTATAATATGTGGGATTTAGG + Intergenic
1017093025 6:150778571-150778593 CATTGTATTATGTGATATGAAGG - Intronic
1018180847 6:161222041-161222063 GACTGCAATATTTGGGATGAGGG + Intronic
1019007627 6:168814542-168814564 CATTTTAATATGTGGAAAGATGG + Intergenic
1019110635 6:169709416-169709438 CAGTTTCATATTTGGGATGGTGG - Intronic
1021553908 7:21900300-21900322 AACTGTAATATTTGGGGTGATGG + Intronic
1022399175 7:30020136-30020158 CATGGAAATATGTGGGATGGGGG - Intronic
1023039696 7:36161309-36161331 CAGGATGATGTGTGGGATGAGGG + Intronic
1023738605 7:43257299-43257321 GAGTCTAATATGTGGCAAGAAGG + Intronic
1024810811 7:53209546-53209568 GAATTTAGTATGTGGGATGAGGG - Intergenic
1028534469 7:91876776-91876798 CAGAGTAGTATGTGGTATTACGG - Intronic
1029143873 7:98431741-98431763 CAGGGGAAGTTGTGGGATGATGG + Intergenic
1031956194 7:127944928-127944950 CAGTGTAATCTCTAGGAAGATGG - Intronic
1034646523 7:152652586-152652608 TAGTGTGATCTGTGTGATGATGG - Intronic
1035071297 7:156147029-156147051 CAGGGTATTAAGTGGGATTAAGG + Intergenic
1039250637 8:35660567-35660589 CAGTGGAATCTGAGTGATGAAGG - Intronic
1039304454 8:36246570-36246592 CAGTGCAAAATGTGAGATGTGGG + Intergenic
1042490121 8:69387788-69387810 CAGTGTCTTAGGTGGAATGAGGG - Intergenic
1047226072 8:122956393-122956415 CAGTGTGATATGTGTTACGATGG + Intronic
1049790526 8:144470290-144470312 CAGAGGGATGTGTGGGATGAAGG - Intronic
1051270590 9:15351547-15351569 CAGTGAAATTTCTGTGATGATGG + Intergenic
1053381958 9:37655956-37655978 CAGTGAAATCCCTGGGATGAGGG - Intronic
1186101301 X:6159570-6159592 CTGTGTAATATGTGGGTGGATGG - Intronic
1186791738 X:13006238-13006260 CAGGGTAATTTCTGGGATGGAGG + Intergenic
1187324896 X:18277813-18277835 CAGTGTAATAGGGGAGAAGATGG + Intronic
1189194300 X:39139682-39139704 AAATGGAATATGTGGTATGAGGG - Intergenic
1191275240 X:58537824-58537846 CAGAGTATTCTTTGGGATGATGG - Intergenic
1194968400 X:100315932-100315954 CAGTTGAATATGATGGATGATGG + Intronic
1196610583 X:117710066-117710088 CAGTGTAATAACTGTTATGATGG + Intergenic
1198446927 X:136726638-136726660 CAGTAGAAAATGTGGGAGGAAGG - Intronic
1198528508 X:137525913-137525935 CAATGTAAAATGTGGCGTGACGG - Intergenic
1199985911 X:152950049-152950071 CAATGTAATTTGGGGGATAAAGG + Intronic
1200987320 Y:9316492-9316514 GAGTGCACTATGTGAGATGACGG - Intergenic
1201747885 Y:17399483-17399505 CAGTATAATATGAGGGTTGAGGG - Intergenic
1202184736 Y:22174579-22174601 GAGTGCACTATGTGAGATGACGG - Intronic
1202206624 Y:22411822-22411844 GAGTGCACTATGTGAGATGACGG + Intronic