ID: 916851256

View in Genome Browser
Species Human (GRCh38)
Location 1:168706539-168706561
Sequence AGGCTTCTTCCCACAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916851247_916851256 27 Left 916851247 1:168706489-168706511 CCCCAAATGGAGTTATGTGTAAA 0: 1
1: 0
2: 0
3: 16
4: 174
Right 916851256 1:168706539-168706561 AGGCTTCTTCCCACAAGAGCTGG 0: 1
1: 1
2: 2
3: 11
4: 181
916851252_916851256 -5 Left 916851252 1:168706521-168706543 CCACAGAGAACAATCCCCAGGCT 0: 1
1: 0
2: 2
3: 10
4: 186
Right 916851256 1:168706539-168706561 AGGCTTCTTCCCACAAGAGCTGG 0: 1
1: 1
2: 2
3: 11
4: 181
916851249_916851256 25 Left 916851249 1:168706491-168706513 CCAAATGGAGTTATGTGTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 188
Right 916851256 1:168706539-168706561 AGGCTTCTTCCCACAAGAGCTGG 0: 1
1: 1
2: 2
3: 11
4: 181
916851248_916851256 26 Left 916851248 1:168706490-168706512 CCCAAATGGAGTTATGTGTAAAG 0: 1
1: 0
2: 0
3: 15
4: 182
Right 916851256 1:168706539-168706561 AGGCTTCTTCCCACAAGAGCTGG 0: 1
1: 1
2: 2
3: 11
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916851256 Original CRISPR AGGCTTCTTCCCACAAGAGC TGG Intronic
900777518 1:4595907-4595929 AGGCCTCTGCCCAGAGGAGCCGG + Intergenic
901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG + Intronic
903350328 1:22712921-22712943 AGGCCTCTTCCAACGAGAGAGGG - Intronic
906925700 1:50113968-50113990 GGGCTGCTTCCCATAAGAACTGG + Intronic
907336196 1:53701378-53701400 AGTCTTCTTCCCCCAAGAAGAGG + Intronic
907903419 1:58762415-58762437 GGGCTCCTTTCCAGAAGAGCTGG + Intergenic
909395181 1:75163826-75163848 AGGGTTCTTCCCTCATGACCTGG - Intergenic
912273387 1:108232013-108232035 TGGCTCCTTCTCACAGGAGCAGG - Intronic
912294833 1:108462309-108462331 TGGCTCCTTCTCACAGGAGCAGG + Intronic
915741334 1:158120596-158120618 AGTCTTCTTTCTACAAGAACAGG - Intergenic
916678174 1:167081764-167081786 AGGCTCCTTCCCTCAACAGATGG + Intronic
916851256 1:168706539-168706561 AGGCTTCTTCCCACAAGAGCTGG + Intronic
920095619 1:203484617-203484639 AAGCATCTTCCCACAGGGGCAGG - Intronic
921763373 1:218942056-218942078 ATGCTTCTTTCTGCAAGAGCTGG + Intergenic
921877994 1:220220657-220220679 CGGCTTCTTCCCACAACACGTGG - Intronic
924121336 1:240801674-240801696 AGGCTTCTTCTCACAGGACATGG + Intronic
1064545453 10:16445757-16445779 AGGATCCTTCCTACAACAGCAGG - Intronic
1067450562 10:46379679-46379701 TGGCTTCTCCCCACAAGCTCTGG + Intronic
1067586681 10:47480072-47480094 TGGCTTCTCCCCACAAGCTCTGG - Intronic
1070309954 10:75265954-75265976 AGGCTCCTGGCCACAGGAGCAGG - Intergenic
1071307284 10:84310643-84310665 CAGCTTCTCCCCACATGAGCAGG + Intergenic
1072541287 10:96399806-96399828 AGGCTTGTTTCCAAAAGAGAGGG + Intronic
1072853441 10:98921772-98921794 AGATTTCTTCCCACAGGTGCAGG + Intronic
1074102987 10:110368197-110368219 ATGCTTCTCCCCACACCAGCAGG - Intergenic
1075745446 10:124724314-124724336 AGGCTCCTTCCACCAAAAGCTGG - Intronic
1075955609 10:126520441-126520463 AGCCTGCTTCCCACAGGGGCTGG + Intronic
1076746313 10:132516413-132516435 AGGCACCTTCCCACCACAGCCGG - Intergenic
1078094587 11:8288998-8289020 AGGCTTCCTTCCCCCAGAGCCGG - Intergenic
1078391471 11:10938820-10938842 AGGCTGATTCACACCAGAGCAGG - Intergenic
1079508034 11:21176633-21176655 AGGATTCTTTACACAAGAGAAGG + Intronic
1082825133 11:57571920-57571942 GGTATTCTTGCCACAAGAGCAGG + Intergenic
1083155611 11:60821115-60821137 AGACTTCTGCCCACACGTGCTGG - Intergenic
1083504699 11:63145072-63145094 AAGAATCTTCCCACAAGAGTAGG - Intronic
1085325360 11:75602270-75602292 AGGCTTCTTCCAACTAGGGCTGG - Intronic
1085462552 11:76702819-76702841 AAGCTTCTTCCATCAAGAGGTGG + Intergenic
1087651532 11:100874214-100874236 AGATTACTTCCCACAATAGCAGG - Intronic
1088081515 11:105921674-105921696 AGGCTTCTTCCCTCACTAGTGGG + Intronic
1089049460 11:115533829-115533851 TGGATTCTTCCCACAGGAGGAGG - Intergenic
1089133982 11:116234807-116234829 GGGCTTCATCCCCCAAGAGAGGG + Intergenic
1089226861 11:116931778-116931800 ACGCTTCTTTCCAAAAAAGCAGG + Intronic
1089492878 11:118894718-118894740 ATGCTCCTTCCAACAGGAGCTGG + Exonic
1090626996 11:128616399-128616421 AGGCCTCTGTCCCCAAGAGCTGG - Intergenic
1091151987 11:133337560-133337582 AGGCTTCTTCCCACAGCAGCAGG - Intronic
1092192649 12:6532292-6532314 TGGCCTCTTCCCACAAATGCTGG - Intergenic
1093093428 12:14946177-14946199 AGGCTTCTTCCCCCTGGAGTGGG - Intronic
1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG + Intronic
1094618632 12:32059153-32059175 TGGATTTTTCCCACAAGAGATGG - Intergenic
1099796648 12:87409053-87409075 AGGCTTCTTCCCAGAAGCATAGG + Intergenic
1099983923 12:89640746-89640768 TGACTACTTCACACAAGAGCAGG + Intronic
1102522162 12:113485177-113485199 AGGCAGCTTCCCAAAAGAGGAGG - Intergenic
1102657139 12:114491532-114491554 GGTCTTCTTCCCTCAAGACCTGG + Intergenic
1104101322 12:125614687-125614709 AGACTGCTTTCCACAAGGGCTGG - Intronic
1106190649 13:27449972-27449994 AGGCCTCCTCCCGCAACAGCAGG + Intronic
1110315346 13:74100209-74100231 AGGCTTCTTACTACAGTAGCAGG + Intronic
1111574033 13:90127051-90127073 AGGCTTCTTCCCTCCATAGTGGG - Intergenic
1114187176 14:20411603-20411625 AGCCTTGTTCCCACAATTGCTGG + Intronic
1114269961 14:21094505-21094527 AGGCTCCCTCACACAAGAGGAGG + Intronic
1116400191 14:44497191-44497213 AGAGTTCTACCCACAAGACCAGG + Intergenic
1117004167 14:51401948-51401970 AGGCCTCCTATCACAAGAGCTGG + Intergenic
1121466543 14:94119151-94119173 AGGCTTTTTCACCCAGGAGCTGG + Intergenic
1122206723 14:100151316-100151338 TGGCTTGTTTCAACAAGAGCAGG + Intronic
1122716411 14:103699240-103699262 AGGCTGCTACCCGCAGGAGCCGG + Intronic
1123002780 14:105305072-105305094 GGGCTGCTTCCCTCATGAGCGGG + Exonic
1127822043 15:62666928-62666950 AGGCTTCATCCCACACCTGCTGG - Intronic
1129519147 15:76175173-76175195 AGCCTTCTTCACAAAGGAGCTGG - Intronic
1129894811 15:79095266-79095288 AGGCCTCATCCCAGAAGAACTGG + Intergenic
1130987224 15:88852380-88852402 AGAGATCTTCCCACAAGAGAGGG - Intronic
1135992480 16:27226587-27226609 GCGCATCCTCCCACAAGAGCTGG - Intronic
1136409233 16:30066616-30066638 AGGCTTTTCCCCACAAGGGAGGG - Intronic
1136713578 16:32259427-32259449 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1136754333 16:32670004-32670026 AGGTTTCTTTCCACCACAGCTGG + Intergenic
1136813780 16:33200361-33200383 AGGTTTCTTTCCACCACAGCTGG - Intronic
1136820256 16:33310441-33310463 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1136826819 16:33366980-33367002 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1136831885 16:33465751-33465773 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1137618789 16:49862398-49862420 AGGGTTCTTCTCACAAGACTTGG + Intergenic
1137801511 16:51266302-51266324 GGGCCACTTCCCACAAGAGCAGG - Intergenic
1140862321 16:79028721-79028743 AAACTTCTTTCCACAAGAGTAGG + Intronic
1140892226 16:79294989-79295011 AGTCTACTTCCCCCTAGAGCAGG + Intergenic
1141009949 16:80387916-80387938 TGGCTTCTTCCCCCCAGGGCTGG + Intergenic
1202992356 16_KI270728v1_random:23335-23357 AGGTTTCTTTCCACCACAGCTGG - Intergenic
1203056480 16_KI270728v1_random:930335-930357 AGGTTTCTTTCCACCACAGCTGG + Intergenic
1143162336 17:4879742-4879764 AAGTTTCTTCCCACTAGGGCTGG + Intronic
1144302453 17:13934571-13934593 AGGGTTATTCCCAGAAGAACTGG + Intergenic
1147136658 17:38437970-38437992 AGCCTTCTTCCCCTGAGAGCTGG - Intronic
1147723039 17:42550348-42550370 AGGCCTCTTCCTCCAAGAGCAGG - Exonic
1147724251 17:42556574-42556596 AGGCCTCTTCCTCCAAGAGCAGG - Intergenic
1148088894 17:45010752-45010774 AGGATTCCTCCCAGAAGAGGTGG + Intergenic
1148355413 17:46972351-46972373 GGACTTCTTCCCACTATAGCTGG - Intronic
1149571465 17:57675256-57675278 AGGCTTCAGCCCTCAGGAGCTGG - Intronic
1150372889 17:64656553-64656575 AGGCTGCTTCTTACAAGAGTTGG - Intronic
1150823648 17:68456752-68456774 AGGTTTCTTCCATCCAGAGCGGG + Intronic
1151618609 17:75231275-75231297 AGGCCGCGTCCCACAAGAGTGGG - Intronic
1151743556 17:76000193-76000215 TGGCTTGTTCCAACAAGGGCAGG - Exonic
1151907257 17:77056576-77056598 AGGTTTCTTCCCTCAACACCCGG - Intergenic
1152497401 17:80683293-80683315 TGTCTTCTCCCGACAAGAGCAGG + Intronic
1161479791 19:4504779-4504801 CGCCTTCCTCCCACAGGAGCGGG - Exonic
1161559136 19:4961427-4961449 AGTCCTCTGCCCACGAGAGCAGG + Exonic
1161986609 19:7658431-7658453 AGGCTTCTTTACCAAAGAGCTGG - Intergenic
1161988874 19:7672728-7672750 AGGCTTTTGCCCACTAGAACAGG - Intergenic
1167604919 19:50476520-50476542 CGGCTTCTTCCCACCAGCGAAGG - Exonic
929296306 2:40251390-40251412 ATGCTTCATCTCAGAAGAGCAGG + Intronic
930632297 2:53767175-53767197 TGGCTTGTTCACAAAAGAGCAGG - Intronic
930962589 2:57278602-57278624 CTGCTAGTTCCCACAAGAGCTGG + Intergenic
931734354 2:65180490-65180512 AGGGTTCCTCCCACAATAGTAGG - Intergenic
933178329 2:79201547-79201569 AAGCTTCTTCCAACAAGAGTTGG + Intronic
935750571 2:106229908-106229930 AGACTTCTTCATCCAAGAGCAGG - Intergenic
937660147 2:124421522-124421544 AGGCTTCTACTCACAAAAGTGGG - Intronic
938933394 2:136107181-136107203 ATCCTCCTTCCCCCAAGAGCTGG + Intergenic
939392785 2:141590629-141590651 ATTTTTCTCCCCACAAGAGCAGG + Intronic
941343292 2:164335274-164335296 AGTCTTCTTCCCTAAAGAGTAGG + Intergenic
943387768 2:187223791-187223813 AGGTTACTTCCCAAGAGAGCAGG - Intergenic
946053189 2:216880742-216880764 TGGCTGCTGGCCACAAGAGCAGG + Intergenic
947869883 2:233428832-233428854 AGGCTTCTTCACAACAGAACAGG + Intronic
948630120 2:239297062-239297084 ATGCTGCTTCCTACAAGGGCTGG + Intronic
948701976 2:239766290-239766312 AGGCTCCTTCCCACAAAGGCAGG + Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1170578251 20:17680837-17680859 TGGCTCCTTCCTACAAGTGCTGG + Intronic
1171152105 20:22836192-22836214 GGGCTTCTTCCCACAGCTGCTGG - Intergenic
1171191689 20:23163532-23163554 GAGCATCTTCCCACCAGAGCAGG + Intergenic
1173143688 20:40506646-40506668 ATGCCTCTTCCCGCAATAGCTGG - Intergenic
1173815258 20:45983407-45983429 AGCCTTCTTCCCAGCAGAGCTGG + Intergenic
1175767698 20:61602612-61602634 AGGGTTTTTCCCCAAAGAGCTGG - Intronic
1181139374 22:20792809-20792831 TGGCTCCTTCCCACAAGTGCAGG - Intronic
953450049 3:42998203-42998225 AGGGTTCTCCACCCAAGAGCTGG + Intronic
955214349 3:56972587-56972609 AGGCTTCTCCCTGCAAGAGCCGG + Intronic
960391648 3:117084314-117084336 TGGGTTCTTCCCACAACAGGTGG - Intronic
961117259 3:124341262-124341284 AGGCTCCTTGCCACTACAGCAGG - Intronic
962380422 3:134894088-134894110 TGGCTTCTTCCTACCAAAGCAGG + Intronic
967092297 3:186145376-186145398 AAGCTTTTTCCTATAAGAGCAGG + Intronic
967755385 3:193162708-193162730 TGGATTTTTCCCACAAGAGACGG - Intergenic
968309546 3:197672339-197672361 AAGCTTCTCCCCGCAACAGCAGG + Intronic
969975568 4:11097724-11097746 AGACTTCTGCCCACAAGCACAGG - Intergenic
975511193 4:75194896-75194918 AGAATTCTCCCCAGAAGAGCAGG + Intergenic
978123474 4:105109413-105109435 AGGCTGCTTCCCAAAACAGTAGG + Intergenic
979714494 4:123820687-123820709 AGGCATCTTCCCACAAAATGAGG - Intergenic
979859008 4:125670236-125670258 AGGTTTCTTCCCAGTACAGCAGG - Intergenic
981238290 4:142443658-142443680 AGGCTACCTCCCACCAGAGGGGG + Intronic
984865965 4:184281081-184281103 TGGCTTCTTCACACAAGGACAGG + Intergenic
985393213 4:189513879-189513901 TGGCTTCTTTACACAAGAGCCGG + Intergenic
989713548 5:44431054-44431076 ATGTTTCTTCCCACATGAGAAGG + Intergenic
990364430 5:55055297-55055319 AGGCTTTTTCTTCCAAGAGCTGG - Intergenic
992883895 5:81138438-81138460 AGCCTTTTTCCCTGAAGAGCTGG + Intronic
993307189 5:86288068-86288090 TGGCTCCTTCTCACAGGAGCAGG + Intergenic
993601075 5:89925515-89925537 AGCCTTCTTCCCATCAGAGGTGG - Intergenic
993951089 5:94176198-94176220 GGATTACTTCCCACAAGAGCAGG + Intronic
994030360 5:95134622-95134644 GGGCTTCTTTGCACAAAAGCTGG + Intronic
996318000 5:122182920-122182942 AGGCTGCTTCTCATCAGAGCTGG + Intergenic
997784662 5:136698971-136698993 TGGCTTCATCCCACAAGCCCTGG - Intergenic
997856494 5:137377427-137377449 AGGCTTCTTCCCTTGAGAGGAGG - Intronic
998608843 5:143665756-143665778 GGGGTTCTTTCCACAAAAGCAGG - Intergenic
999201682 5:149821059-149821081 AGTCTTCTTGCCTCCAGAGCCGG + Intronic
999212631 5:149903546-149903568 AGGCTGCTTCCCAGCAGAGTGGG + Intronic
1001406824 5:171482478-171482500 AGGCCTCCTCCCACATGAGGGGG + Intergenic
1003215577 6:4106403-4106425 TTGTTTCTTCCCACAAGTGCAGG - Intronic
1003534582 6:6965524-6965546 AGGCTTCCTCACACTACAGCTGG - Intergenic
1005051482 6:21687819-21687841 AGGCCTCCTCCCAAAAGACCAGG + Intergenic
1007226597 6:40319871-40319893 AGGCTCCTTCCCCATAGAGCAGG - Intergenic
1008740958 6:54607638-54607660 AGAATCCTTCCCACAAGATCAGG - Intergenic
1011756986 6:90509663-90509685 TGCCTTCATCCTACAAGAGCTGG - Intergenic
1018268547 6:162051688-162051710 AGGCTTCTTCCCATCAGCCCTGG - Intronic
1024802828 7:53100792-53100814 AGGCTTGTGCCCACAAGAATTGG - Intergenic
1025255458 7:57381544-57381566 AGGCTACATCCCACATGAGTGGG - Intergenic
1028699664 7:93762566-93762588 GGGTTTCTTCCCACTAGATCTGG + Intronic
1030783206 7:113627174-113627196 AGGGTTCTCCCCAAATGAGCTGG - Intergenic
1031377690 7:121048316-121048338 AAGCTTCTGAACACAAGAGCAGG - Intronic
1031724884 7:125226012-125226034 AGGCTTCCTCCCCCAACAGAAGG + Intergenic
1034364914 7:150537884-150537906 AGGCTTCTGCCCACAAGCCCAGG + Intergenic
1035176658 7:157056644-157056666 CGGGTTCTTCCCAGAAGGGCAGG - Intergenic
1037000156 8:13707604-13707626 AGGCTTCCACCCACAAAATCTGG - Intergenic
1037710870 8:21354570-21354592 AGGCTTCTGCCTTCAACAGCTGG + Intergenic
1038323605 8:26552709-26552731 GGGCTACTTATCACAAGAGCGGG - Intronic
1040516643 8:48141163-48141185 AGGCTTCTTTCCAAAACACCAGG - Intergenic
1040594231 8:48822141-48822163 AGGCTTCCTGACACCAGAGCTGG + Intergenic
1042219712 8:66461389-66461411 AGCCTGCTTGCCACAAGTGCTGG + Intronic
1042249230 8:66739300-66739322 GGATTACTTCCCACAAGAGCAGG - Intronic
1044958927 8:97510643-97510665 ATACTTCTTCCAACAAGAGAAGG + Intergenic
1047068405 8:121314195-121314217 AGACTACTGCCAACAAGAGCAGG - Intergenic
1049725307 8:144142969-144142991 AGGCTTCTGCCCACATGGTCAGG + Intergenic
1051523406 9:18015711-18015733 AAGCTTCTTCCCACAAGACCAGG + Intergenic
1052675130 9:31612120-31612142 TGTTTTCTTGCCACAAGAGCTGG + Intergenic
1055152485 9:73019470-73019492 CTGCTAGTTCCCACAAGAGCTGG - Intronic
1055641674 9:78323729-78323751 ACCCCTCTTCCCACAAGAGGTGG - Intronic
1056975982 9:91254327-91254349 AGGCCTCTCCCAACAACAGCAGG + Intronic
1057357154 9:94341021-94341043 AGACTTCTTCCTCCAAGGGCTGG - Intergenic
1057582380 9:96298811-96298833 AGCCTTCACCCCACAAGGGCAGG + Intronic
1057650597 9:96916606-96916628 AGACTTCTTCCTCCAAGGGCTGG + Intronic
1059613506 9:115924278-115924300 AGGCTTCTTTCCTGAAAAGCTGG + Intergenic
1060797340 9:126521819-126521841 AGGCTCCTTCCCCCAAGATTCGG - Intergenic
1060858186 9:126932878-126932900 AGGCTTGCCACCACAAGAGCGGG + Intronic
1061117936 9:128626422-128626444 AGGCTTCTGCCTTCAACAGCTGG + Exonic
1061404344 9:130385279-130385301 AGGCTTTTTCCTACAGGGGCAGG - Intronic
1189304180 X:39974316-39974338 AGGCTTCTTGCCTAAAGAGAAGG - Intergenic
1193365541 X:80627978-80628000 AGGAATGTTCCCACAAGAGTGGG + Intergenic
1194918761 X:99737237-99737259 ATCCTTCTTCCCCCAACAGCAGG - Intergenic
1195724992 X:107905654-107905676 TGGCCTCTTTTCACAAGAGCAGG - Intronic