ID: 916854726

View in Genome Browser
Species Human (GRCh38)
Location 1:168737832-168737854
Sequence GCACGTGCATATACTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916854726_916854728 19 Left 916854726 1:168737832-168737854 CCCTGCAGAGTATATGCACGTGC No data
Right 916854728 1:168737874-168737896 TGCACATACTTTAATTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916854726 Original CRISPR GCACGTGCATATACTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr