ID: 916861354

View in Genome Browser
Species Human (GRCh38)
Location 1:168809198-168809220
Sequence CAGAGCCAACACTTAAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916861354_916861357 4 Left 916861354 1:168809198-168809220 CCCAATTTTAAGTGTTGGCTCTG No data
Right 916861357 1:168809225-168809247 ATTGAGAGCTGTCCTTCCTAGGG No data
916861354_916861356 3 Left 916861354 1:168809198-168809220 CCCAATTTTAAGTGTTGGCTCTG No data
Right 916861356 1:168809224-168809246 AATTGAGAGCTGTCCTTCCTAGG No data
916861354_916861358 10 Left 916861354 1:168809198-168809220 CCCAATTTTAAGTGTTGGCTCTG No data
Right 916861358 1:168809231-168809253 AGCTGTCCTTCCTAGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916861354 Original CRISPR CAGAGCCAACACTTAAAATT GGG (reversed) Intergenic
No off target data available for this crispr