ID: 916868702

View in Genome Browser
Species Human (GRCh38)
Location 1:168888443-168888465
Sequence CCAGGTACTCCCACTCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916868696_916868702 12 Left 916868696 1:168888408-168888430 CCAGAGGAGCAACAACACTCACA No data
Right 916868702 1:168888443-168888465 CCAGGTACTCCCACTCTTAGGGG No data
916868695_916868702 13 Left 916868695 1:168888407-168888429 CCCAGAGGAGCAACAACACTCAC No data
Right 916868702 1:168888443-168888465 CCAGGTACTCCCACTCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916868702 Original CRISPR CCAGGTACTCCCACTCTTAG GGG Intergenic
No off target data available for this crispr