ID: 916869459

View in Genome Browser
Species Human (GRCh38)
Location 1:168896940-168896962
Sequence CTGTGGTTCTTAAGGAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916869459_916869464 7 Left 916869459 1:168896940-168896962 CCACTTTTCCTTAAGAACCACAG No data
Right 916869464 1:168896970-168896992 GATTGTTCAGACTATGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916869459 Original CRISPR CTGTGGTTCTTAAGGAAAAG TGG (reversed) Intergenic
No off target data available for this crispr