ID: 916871899

View in Genome Browser
Species Human (GRCh38)
Location 1:168924212-168924234
Sequence AACTTCTACTAGTATTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916871899_916871902 18 Left 916871899 1:168924212-168924234 CCACAAAAATACTAGTAGAAGTT No data
Right 916871902 1:168924253-168924275 ATAGGATAATGAAAGAGGAATGG No data
916871899_916871900 0 Left 916871899 1:168924212-168924234 CCACAAAAATACTAGTAGAAGTT No data
Right 916871900 1:168924235-168924257 ATTGCAATTTACAGAGCTATAGG No data
916871899_916871901 13 Left 916871899 1:168924212-168924234 CCACAAAAATACTAGTAGAAGTT No data
Right 916871901 1:168924248-168924270 GAGCTATAGGATAATGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916871899 Original CRISPR AACTTCTACTAGTATTTTTG TGG (reversed) Intergenic
No off target data available for this crispr