ID: 916871902

View in Genome Browser
Species Human (GRCh38)
Location 1:168924253-168924275
Sequence ATAGGATAATGAAAGAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916871898_916871902 19 Left 916871898 1:168924211-168924233 CCCACAAAAATACTAGTAGAAGT No data
Right 916871902 1:168924253-168924275 ATAGGATAATGAAAGAGGAATGG No data
916871899_916871902 18 Left 916871899 1:168924212-168924234 CCACAAAAATACTAGTAGAAGTT No data
Right 916871902 1:168924253-168924275 ATAGGATAATGAAAGAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916871902 Original CRISPR ATAGGATAATGAAAGAGGAA TGG Intergenic
No off target data available for this crispr