ID: 916873466

View in Genome Browser
Species Human (GRCh38)
Location 1:168942244-168942266
Sequence GAGGCTAATCTGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916873466_916873472 5 Left 916873466 1:168942244-168942266 CCAGCCTCCCTCAGATTAGCCTC No data
Right 916873472 1:168942272-168942294 TTACAGCGAATGGAACTCAAAGG No data
916873466_916873470 -5 Left 916873466 1:168942244-168942266 CCAGCCTCCCTCAGATTAGCCTC No data
Right 916873470 1:168942262-168942284 GCCTCAGATCTTACAGCGAATGG No data
916873466_916873473 24 Left 916873466 1:168942244-168942266 CCAGCCTCCCTCAGATTAGCCTC No data
Right 916873473 1:168942291-168942313 AAGGCCCCAAGAGAGATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916873466 Original CRISPR GAGGCTAATCTGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr