ID: 916874804

View in Genome Browser
Species Human (GRCh38)
Location 1:168958018-168958040
Sequence CAGTAAATACAAATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916874799_916874804 25 Left 916874799 1:168957970-168957992 CCTAATAGAAGGTGGAGCTCATG No data
Right 916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916874804 Original CRISPR CAGTAAATACAAATGAAGCT TGG Intergenic
No off target data available for this crispr