ID: 916877064

View in Genome Browser
Species Human (GRCh38)
Location 1:168980594-168980616
Sequence CTTAAATGCCCTTCCTGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916877064_916877067 6 Left 916877064 1:168980594-168980616 CCATTACAGGAAGGGCATTTAAG No data
Right 916877067 1:168980623-168980645 CTAATGACAATATATCTGAGGGG No data
916877064_916877066 5 Left 916877064 1:168980594-168980616 CCATTACAGGAAGGGCATTTAAG No data
Right 916877066 1:168980622-168980644 GCTAATGACAATATATCTGAGGG No data
916877064_916877065 4 Left 916877064 1:168980594-168980616 CCATTACAGGAAGGGCATTTAAG No data
Right 916877065 1:168980621-168980643 TGCTAATGACAATATATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916877064 Original CRISPR CTTAAATGCCCTTCCTGTAA TGG (reversed) Intergenic
No off target data available for this crispr