ID: 916881004

View in Genome Browser
Species Human (GRCh38)
Location 1:169019393-169019415
Sequence GTGAGGAATCTTAATCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916881004_916881007 28 Left 916881004 1:169019393-169019415 CCTGCAGGATTAAGATTCCTCAC No data
Right 916881007 1:169019444-169019466 AAAGTCTCAAGTCTGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916881004 Original CRISPR GTGAGGAATCTTAATCCTGC AGG (reversed) Intergenic
No off target data available for this crispr