ID: 916884430

View in Genome Browser
Species Human (GRCh38)
Location 1:169053158-169053180
Sequence TGCCAATTAGAAATCCAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916884428_916884430 7 Left 916884428 1:169053128-169053150 CCTTGATCAGATTGAATTCTGGG No data
Right 916884430 1:169053158-169053180 TGCCAATTAGAAATCCAAAGCGG No data
916884426_916884430 8 Left 916884426 1:169053127-169053149 CCCTTGATCAGATTGAATTCTGG No data
Right 916884430 1:169053158-169053180 TGCCAATTAGAAATCCAAAGCGG No data
916884424_916884430 19 Left 916884424 1:169053116-169053138 CCAATCCTAATCCCTTGATCAGA No data
Right 916884430 1:169053158-169053180 TGCCAATTAGAAATCCAAAGCGG No data
916884425_916884430 14 Left 916884425 1:169053121-169053143 CCTAATCCCTTGATCAGATTGAA No data
Right 916884430 1:169053158-169053180 TGCCAATTAGAAATCCAAAGCGG No data
916884423_916884430 23 Left 916884423 1:169053112-169053134 CCTTCCAATCCTAATCCCTTGAT No data
Right 916884430 1:169053158-169053180 TGCCAATTAGAAATCCAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916884430 Original CRISPR TGCCAATTAGAAATCCAAAG CGG Intergenic
No off target data available for this crispr