ID: 916890197

View in Genome Browser
Species Human (GRCh38)
Location 1:169106400-169106422
Sequence CCCCGGGCCTGTCTCTGCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 298}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916890191_916890197 -5 Left 916890191 1:169106382-169106404 CCCTCTCTGACTCTCCTACCCCG 0: 1
1: 0
2: 3
3: 37
4: 415
Right 916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 35
4: 298
916890187_916890197 18 Left 916890187 1:169106359-169106381 CCGCAGTCCGCTTGTCCGTCCTT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 35
4: 298
916890192_916890197 -6 Left 916890192 1:169106383-169106405 CCTCTCTGACTCTCCTACCCCGG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 35
4: 298
916890190_916890197 -1 Left 916890190 1:169106378-169106400 CCTTCCCTCTCTGACTCTCCTAC 0: 1
1: 0
2: 7
3: 129
4: 1516
Right 916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 35
4: 298
916890184_916890197 29 Left 916890184 1:169106348-169106370 CCGGTGGCGCCCCGCAGTCCGCT 0: 1
1: 0
2: 0
3: 6
4: 66
Right 916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 35
4: 298
916890188_916890197 11 Left 916890188 1:169106366-169106388 CCGCTTGTCCGTCCTTCCCTCTC 0: 1
1: 1
2: 8
3: 93
4: 985
Right 916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 35
4: 298
916890189_916890197 3 Left 916890189 1:169106374-169106396 CCGTCCTTCCCTCTCTGACTCTC 0: 1
1: 3
2: 111
3: 1780
4: 9169
Right 916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 35
4: 298
916890185_916890197 20 Left 916890185 1:169106357-169106379 CCCCGCAGTCCGCTTGTCCGTCC 0: 1
1: 0
2: 0
3: 6
4: 44
Right 916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 35
4: 298
916890186_916890197 19 Left 916890186 1:169106358-169106380 CCCGCAGTCCGCTTGTCCGTCCT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG 0: 1
1: 0
2: 3
3: 35
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916890197 Original CRISPR CCCCGGGCCTGTCTCTGCAG AGG Exonic
900208439 1:1441406-1441428 CCCCCTGCCTGTGTGTGCAGGGG + Exonic
900290129 1:1920234-1920256 CCCCAGGCCTGCCCCTGCACAGG - Intergenic
900291495 1:1925581-1925603 CCCGGGGCCTGTTTCTGGGGAGG - Intronic
900634117 1:3653252-3653274 CTCCTGGCCTGTCTCCGGAGCGG + Intronic
900801105 1:4737536-4737558 CCCTGGCCCTGCCTATGCAGAGG - Intronic
901432455 1:9225346-9225368 CCCCAGCCCTGACACTGCAGTGG - Intergenic
901454244 1:9354124-9354146 GCCAGGGCCAGGCTCTGCAGTGG - Intronic
903745556 1:25584455-25584477 CCCTGGGCCTGTCTGAGCAGGGG - Intergenic
904002149 1:27344900-27344922 GTCCGGGTCTGTGTCTGCAGAGG + Exonic
904396503 1:30225855-30225877 TCCCAGGCCTGTCTCTAGAGGGG + Intergenic
904433121 1:30477866-30477888 GCCCTGGCCTGTGTCTGAAGTGG - Intergenic
905375633 1:37518389-37518411 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
906715994 1:47969762-47969784 CCCCAGGGCTGGCTCTGCAAGGG - Intronic
912315931 1:108667613-108667635 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
912818761 1:112850357-112850379 CCGCGGGCCTGGCTCTGTGGTGG - Intergenic
913453567 1:119008458-119008480 TCCCGGGCGTGTGTGTGCAGTGG + Intergenic
914928062 1:151906274-151906296 ACCCGGGCCAGTGGCTGCAGAGG + Intronic
915523649 1:156463351-156463373 GCCCGGGCAAGTCTCTGCTGAGG + Intergenic
916653290 1:166850207-166850229 CCCTGGGCCTCTTTCTGGAGTGG + Exonic
916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG + Exonic
917133086 1:171762157-171762179 CTTCGGGCCTGTCTCTGAGGTGG + Intergenic
920065957 1:203269871-203269893 TCCCGGGGAAGTCTCTGCAGAGG + Intronic
920212042 1:204335399-204335421 TCCAGGGCCTTTCTCTGCTGGGG - Intronic
920832594 1:209478987-209479009 CCCCGGGCCTGTGACTGCTTAGG - Intergenic
922806984 1:228395250-228395272 CCTTGGGCCTCTCTCTGCAGGGG - Exonic
924560831 1:245155588-245155610 CCCCGGGGGCGCCTCTGCAGCGG - Intronic
924784733 1:247184438-247184460 TCACAGGCCTGTCACTGCAGAGG + Intergenic
1062897816 10:1117788-1117810 CCCGGGCCCTGGCTCTGCAGTGG - Intronic
1062960564 10:1570621-1570643 CCCCTGGCCTGTCACAGCAGTGG + Intronic
1064197792 10:13259743-13259765 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
1067045705 10:42984006-42984028 CCCCTGGCCTGTCTCTTTAGAGG + Intergenic
1070674192 10:78400723-78400745 GCAGGGGCCTTTCTCTGCAGCGG + Intergenic
1073101840 10:101010586-101010608 CCCCGGATCTGGCTCTGCGGAGG + Intronic
1074180735 10:111060343-111060365 CCCTGGGGGTGTTTCTGCAGGGG - Intergenic
1074592068 10:114822302-114822324 CCTCGGGCCTGGCTCTGCGGGGG + Intronic
1075632311 10:124007978-124008000 CCAGGGGCCTTTCTCTCCAGAGG - Exonic
1075683645 10:124349448-124349470 CCCCTGTCCTGCTTCTGCAGGGG + Intergenic
1076785988 10:132750180-132750202 CCTCGGGCCTCACTCTGAAGTGG + Intronic
1076859394 10:133133526-133133548 GGCCGGCCCTGTGTCTGCAGGGG + Intergenic
1077077411 11:707804-707826 CCCCAGGCCTGAGTCTGCAAGGG + Intronic
1077118101 11:894475-894497 CTCCAGGCCAGTTTCTGCAGAGG - Intronic
1077770662 11:5215262-5215284 CCTCGGGGCTGTTTCTCCAGTGG - Intergenic
1078071314 11:8113414-8113436 CCCGGAGTCTGTATCTGCAGGGG - Intronic
1078509832 11:11976995-11977017 CCACAGGGCAGTCTCTGCAGCGG - Intronic
1081528594 11:43943185-43943207 CGCAGAGCCTGTCGCTGCAGCGG + Exonic
1081763413 11:45592681-45592703 CCTTGGGCTTGTCTCTGCAGTGG + Intergenic
1083744107 11:64725843-64725865 CCCCAGCCCTGTCTCTGCATCGG - Intergenic
1083767949 11:64851169-64851191 CCCCAGGCCAGCCTCTGAAGAGG + Intergenic
1084585961 11:70062629-70062651 CTCCGTGCCTGTCTCAGCAAGGG + Intergenic
1084891541 11:72239383-72239405 CCCCTTCCCTGGCTCTGCAGCGG - Exonic
1085351413 11:75800334-75800356 CCTCTGCCCTGTCCCTGCAGTGG + Exonic
1086408015 11:86515895-86515917 CCGCAGGCCAGGCTCTGCAGAGG + Intronic
1086808018 11:91268894-91268916 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
1088253254 11:107879929-107879951 CCCCGTCCCTGTCTCTGTACAGG - Intronic
1088750098 11:112835986-112836008 CCCCGGGCCGGTCCCTGCTCAGG - Intergenic
1088896529 11:114082911-114082933 CCGCGGGCCAGTCTCGGCTGTGG + Intronic
1090330283 11:125926124-125926146 CAGCTGGACTGTCTCTGCAGGGG - Intergenic
1091233451 11:134003085-134003107 ACCCGGGCCAGTCGCTGCGGAGG - Intergenic
1091795661 12:3296242-3296264 CCCCAGGCCTTTCTAGGCAGAGG + Intergenic
1092183350 12:6461251-6461273 CACTGGGCCTGGCTCTGCAGAGG + Intronic
1094666488 12:32525811-32525833 ACCCGGGCCAGTGGCTGCAGAGG + Intronic
1095982671 12:47981988-47982010 CCCTGGTCCTGTCTCTGTCGGGG - Intronic
1096007180 12:48183135-48183157 CACCGGGCCTGACGGTGCAGAGG - Intergenic
1098049265 12:66436304-66436326 CCCAGTGCCTTTCTCTGCATTGG - Intronic
1098391828 12:69977653-69977675 ACTCGGGCATGTCTTTGCAGTGG - Intergenic
1102469272 12:113150423-113150445 TCCTGGGCCTCTCCCTGCAGAGG + Intronic
1102952183 12:117038241-117038263 ACCCGAGCCTGTCCCTGCTGTGG - Intergenic
1102952190 12:117038270-117038292 CCCCGAGCCTGTGCCTGCTGCGG - Intergenic
1104560508 12:129839839-129839861 CCGCAGGCTTGGCTCTGCAGCGG - Intronic
1104748323 12:131223428-131223450 CACCGGGCCATTCTCTGCAGGGG - Intergenic
1105068460 12:133219312-133219334 CCCCGGCCCTGTGTCTGCCATGG - Exonic
1105281223 13:18963781-18963803 CCCCAGCCCAGTCCCTGCAGAGG - Intergenic
1105290426 13:19049791-19049813 CCCCGGCCCAGTCCCTGCAGAGG - Intergenic
1107016890 13:35714714-35714736 CCTGAGGCCAGTCTCTGCAGCGG + Intergenic
1107859638 13:44648539-44648561 CCTTGGGGCTGCCTCTGCAGAGG + Intergenic
1108596431 13:51954063-51954085 CCCCAGGCCTGGCTCAGCTGTGG - Intronic
1109141047 13:58714220-58714242 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
1113378239 13:109783363-109783385 CCACGCGCCTGTCCCTGGAGGGG - Exonic
1113776989 13:112953546-112953568 CCTTGTTCCTGTCTCTGCAGAGG - Intronic
1113819823 13:113204933-113204955 CCCCAGGCCTGGCTCACCAGGGG + Intronic
1113913643 13:113856984-113857006 GCCTGGGCCGGTCACTGCAGTGG - Intronic
1113939325 13:114010370-114010392 GCCCAAGGCTGTCTCTGCAGGGG - Intronic
1117302511 14:54443189-54443211 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
1117438962 14:55742810-55742832 CCGGGGGCCTGCATCTGCAGTGG - Intergenic
1117571923 14:57056838-57056860 ACCCGGGCCAGTGGCTGCAGAGG - Intergenic
1119728340 14:76935746-76935768 CCATGGGCCTGGCTCTGGAGAGG + Intergenic
1119733359 14:76965206-76965228 CTCCTGGACTGACTCTGCAGCGG - Intergenic
1120425459 14:84341702-84341724 CCCCGGCTCTGTCTCTGTACAGG + Intergenic
1122460369 14:101889522-101889544 CCTTGGCCCTGTCTTTGCAGTGG + Intronic
1122637302 14:103136115-103136137 CCCAGGGCCTGTCCCTGCCTTGG - Exonic
1122741295 14:103872838-103872860 CCCTGGGCCTGCCTCTGGAGGGG - Intergenic
1125328635 15:38562391-38562413 CTTCTAGCCTGTCTCTGCAGTGG - Intronic
1129392968 15:75229679-75229701 CCACAGGCCTGGCTCTGTAGCGG - Intergenic
1129733357 15:77944394-77944416 CCCCGCCCCTGTCTCGGGAGCGG + Intergenic
1130670585 15:85908911-85908933 TCCCAGGCCAGTCTCAGCAGGGG - Intergenic
1131178691 15:90225641-90225663 CCCCGTGTCTGGCTGTGCAGGGG + Exonic
1131525289 15:93147715-93147737 CCCAGATCCAGTCTCTGCAGAGG - Intergenic
1132463693 16:68003-68025 CCCCAGGACTGTCTCAGCCGGGG + Intronic
1132463708 16:68049-68071 CCCCAGGACTGTCTCAGCCGGGG + Intronic
1132513156 16:353780-353802 CCCCTGGGCTGTCTCCACAGCGG + Intergenic
1132678228 16:1129451-1129473 GCCCGGGCCTGCCCCTGCTGCGG + Intergenic
1132724034 16:1331175-1331197 CCCCAGGCCTCACTCTGAAGGGG - Intergenic
1132808387 16:1786341-1786363 CCCCGGGTCTGGGGCTGCAGGGG + Intronic
1132936241 16:2482785-2482807 GCCCGTGCCTGTCTCTCCAATGG - Intronic
1133220000 16:4315857-4315879 CCCCGGGCCTGGGGCCGCAGCGG + Intronic
1134761407 16:16718212-16718234 CCAGGAGCCTGTCCCTGCAGAGG - Intergenic
1134984652 16:18640958-18640980 CCAGGAGCCTGTCCCTGCAGAGG + Intergenic
1135326310 16:21527948-21527970 CCCCGGGCCTGGTTCAGGAGCGG + Intergenic
1136282317 16:29221036-29221058 CCTGGAGCCCGTCTCTGCAGTGG - Intergenic
1136554107 16:30997658-30997680 CCCCGGGCCTGGCGCTGCCGCGG - Intronic
1136669205 16:31840218-31840240 GCCGGAGCCTGTGTCTGCAGGGG - Intergenic
1137575137 16:49594382-49594404 CCCCAGGCCTCTCTCAACAGAGG + Intronic
1141135223 16:81460407-81460429 CCCTGGGCCTGACACTGCAGGGG - Intronic
1141556864 16:84842163-84842185 CCCGGGGGCTGTTTCTGAAGGGG + Intronic
1141754142 16:85980136-85980158 CCCCGGGCATCTGTCTGAAGCGG - Intergenic
1142086689 16:88186954-88186976 CCTGGAGCCCGTCTCTGCAGTGG - Intergenic
1142134694 16:88446275-88446297 CCTGGGGCCTGGCTCTGCACTGG + Intergenic
1142282560 16:89156258-89156280 CCCCCGGCCTGTGTCTCCAGAGG - Intergenic
1142413424 16:89927819-89927841 CCCTGTGCCTCGCTCTGCAGAGG + Intronic
1142468262 17:147998-148020 CCCTGGGCCTGTCTCTTCCTGGG + Intronic
1142601156 17:1053571-1053593 CCCTGGGCCTGCCTGTCCAGAGG + Intronic
1143174731 17:4949425-4949447 CCCTTGGCCTGTGTCTGCAGAGG + Intronic
1143180477 17:4981233-4981255 ACCCACGCCTGTCTCTGCAGTGG - Exonic
1144058065 17:11559050-11559072 CCCTGGGCCTGTCCTTTCAGCGG + Exonic
1145747880 17:27333269-27333291 CCCCGGGTCCCTCTCTGGAGGGG - Intergenic
1146000648 17:29128362-29128384 CCCAGGGCCTGTCCCGGAAGCGG - Intronic
1146515564 17:33486568-33486590 CCCCAGTCCTGTCCCTGTAGGGG - Intronic
1147374816 17:40017190-40017212 CCCCAGCCCTGGCTCTGCAATGG + Exonic
1147982542 17:44283464-44283486 CCACAGGCCTGTCCCTGCACTGG + Intergenic
1147995629 17:44358857-44358879 CCCCTGGCCTTCCTCTCCAGTGG + Intronic
1148547732 17:48530253-48530275 CCCAGGACATGTCACTGCAGGGG + Intronic
1148565960 17:48633235-48633257 CCAGGGCCCTGGCTCTGCAGAGG + Intronic
1149657822 17:58319511-58319533 CCCCGGCCTTGGCTCTGGAGGGG - Intronic
1151438915 17:74115604-74115626 CCCCATGCCTGGCTTTGCAGAGG - Intergenic
1152434042 17:80264366-80264388 CCCCGCTCCTGTCTCTCCACTGG - Intronic
1152804477 17:82348561-82348583 CCCAGGGCCTGGGGCTGCAGGGG + Intergenic
1152896786 17:82915947-82915969 CACCGGCCATGTCTCTGCTGAGG - Intronic
1153137335 18:1930704-1930726 CCCGGGGCCTGTGTTTGCAGTGG - Intergenic
1155208051 18:23577853-23577875 ACCCGGGCCAGTGGCTGCAGAGG - Intronic
1156099591 18:33578255-33578277 CCCCGGAGCTGTCACCGCAGCGG + Intergenic
1157123798 18:44936385-44936407 CCCCATGGCTGTCTCTGAAGTGG + Intronic
1157426092 18:47585317-47585339 GACCGGGCCTGTCACTCCAGTGG + Intergenic
1158318507 18:56237971-56237993 CCTGGGGCCTGTCTGTCCAGAGG - Intergenic
1160176621 18:76600352-76600374 ACCCGGGCCAGTCGCTGCGGAGG - Intergenic
1160232059 18:77056139-77056161 GCCCGGGGCTGGGTCTGCAGAGG + Intronic
1160517007 18:79484160-79484182 GCCAGGGGCTGCCTCTGCAGTGG - Intronic
1161459075 19:4385821-4385843 CTCCGAGCCAGCCTCTGCAGTGG + Intronic
1161667642 19:5586692-5586714 CCCCGAGCCTGTCTCTGCGTGGG - Intergenic
1161735878 19:5991804-5991826 CACTGGGCCTGGCTCTTCAGGGG + Intergenic
1161772628 19:6239359-6239381 CTCCGGGTCTCCCTCTGCAGGGG - Intronic
1161800437 19:6414522-6414544 TCCCGGGCTTGTCTGTGAAGTGG - Intronic
1162283666 19:9720834-9720856 CCTCGTGCCTTTCACTGCAGGGG + Intergenic
1162996675 19:14340184-14340206 CACCGTGCCTGGCTTTGCAGAGG - Intergenic
1163314599 19:16533206-16533228 CCTCCGGCCTGGCTCAGCAGGGG + Intronic
1163826590 19:19527803-19527825 CCCAGGCCCTGTCTCTGCCGTGG - Intronic
1164740823 19:30574357-30574379 CTCTGGGCCTTTCTTTGCAGAGG - Intronic
1164981821 19:32619884-32619906 CCCCAGGCCTGTCTGTCCACAGG + Intronic
1165221123 19:34317514-34317536 CCCCCTCCCTGTGTCTGCAGTGG + Intronic
1165420046 19:35718048-35718070 CCCCGGGCCTGGCTCCGCGCGGG + Exonic
1165814447 19:38633064-38633086 CCACGGGCCTCTCTCTACGGAGG - Intronic
1167715140 19:51138196-51138218 CCCTGAGCCTCTCTGTGCAGAGG + Intergenic
1168144247 19:54410869-54410891 CCCTGGGTCTGTTTCTGCTGAGG - Intergenic
925071658 2:974010-974032 CCCTGGGCCTGTCTCTGTGATGG + Intronic
925260446 2:2524171-2524193 TCCTGGCCCTGGCTCTGCAGTGG + Intergenic
925350537 2:3198084-3198106 GCCCCTGCCTGTCTATGCAGTGG - Intronic
925496284 2:4453062-4453084 CCCAGGGCCTGTCGGTGCATGGG - Intergenic
926137449 2:10346827-10346849 GCCAGGGCCTGTCTGTGCTGGGG - Intronic
926889440 2:17626568-17626590 CCCTGCCCCTGTGTCTGCAGAGG + Intronic
926891719 2:17644494-17644516 CCCTCGGCCTGTCTCTTCCGGGG - Intronic
927141813 2:20136121-20136143 CCCAGGACCTGTCTCTGCACTGG - Intergenic
927692719 2:25219634-25219656 CCAGGGGGCTGGCTCTGCAGAGG - Intergenic
927853355 2:26513451-26513473 CCCGGGGCCTGTCTGGGCTGAGG + Intronic
928014009 2:27637046-27637068 GCCCCGGCTGGTCTCTGCAGGGG - Intronic
928245914 2:29626873-29626895 CCCAGGCACTATCTCTGCAGAGG - Intronic
929037224 2:37705853-37705875 CCCCTGGTCAGTGTCTGCAGGGG + Intronic
929484333 2:42340751-42340773 CCCGGGGCCTGGCCCTGCACTGG + Intronic
931221730 2:60294910-60294932 CCCCTGGCCAGGGTCTGCAGTGG + Intergenic
931718142 2:65045763-65045785 CCTCGTGCCTTTCTCTGCGGGGG - Intergenic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932359522 2:71092710-71092732 ACCCGGGCCAGTGGCTGCAGAGG - Intergenic
932688134 2:73891002-73891024 CCTCTGGGCTGTCTCAGCAGAGG + Intergenic
932739957 2:74283673-74283695 GCCCAGGTCTGTCTCTGCATGGG - Intronic
933791850 2:85889163-85889185 CCCCGGGTGCGTCCCTGCAGGGG - Intergenic
934612761 2:95753160-95753182 CCCCGTGCCACTCTATGCAGAGG - Intergenic
934648152 2:96071263-96071285 CCCCGTGCCACTCTATGCAGAGG + Intergenic
935598790 2:104901183-104901205 CTCCTGGGCTGTCTCTCCAGTGG - Intergenic
940261057 2:151780188-151780210 CCTTGGGCCCATCTCTGCAGGGG - Intergenic
941662689 2:168211466-168211488 CTCCTGGCCTGTCTCTTCACAGG - Intronic
941881889 2:170489283-170489305 CCACAGGGCTGTCTCTGCAAGGG - Intronic
948505726 2:238426087-238426109 CCCAGGGCCAGCCTCAGCAGGGG + Intergenic
948814521 2:240502981-240503003 CCCAGAGCCCGTCTCTCCAGTGG + Intronic
948909122 2:240994217-240994239 TCTCAGGCCTGTCCCTGCAGGGG + Intergenic
1169119150 20:3084873-3084895 ACGTGGGCCTGTCTGTGCAGGGG + Intergenic
1170573907 20:17648367-17648389 CCCAGGGCCTGCCTCAGCTGTGG - Intronic
1171318853 20:24220943-24220965 ACCCGGGCCAGTGGCTGCAGAGG - Intergenic
1175940486 20:62535476-62535498 CCCCGGGCCTCTCTCTGGGCTGG - Intergenic
1176125018 20:63471461-63471483 CCCCGGGCCTCGCTCTGCCAAGG + Intronic
1176191765 20:63814537-63814559 CCCAAGACCTGCCTCTGCAGGGG + Intronic
1178439565 21:32587221-32587243 CCCCATCCCTGTCTCTGCTGCGG + Intronic
1179447805 21:41445363-41445385 TCCCGGGCCTCCCTCTGCAGAGG - Intronic
1179713717 21:43277068-43277090 CCCCGTCCCATTCTCTGCAGTGG + Intergenic
1180999867 22:19983075-19983097 CCCCGGGCCTCTGACTGCACAGG + Intronic
1181235902 22:21447481-21447503 CCCCGGCTCTGGCGCTGCAGGGG + Exonic
1181829443 22:25547964-25547986 CCCTGGGCATGACTCTGCAGAGG - Intergenic
1182712717 22:32332580-32332602 CTCCGGCCCTGTCTCTGCAGAGG - Intergenic
1183589381 22:38770861-38770883 ACCCCTGCCTGTCTCTCCAGAGG + Intronic
1184399959 22:44267962-44267984 CTCCGGCCGTGTCTCTGCAGAGG - Intronic
1185015325 22:48339450-48339472 CCCTGGGGCCGCCTCTGCAGAGG + Intergenic
1185246172 22:49774551-49774573 CCTCGGGCCTGTCCCTGCACGGG - Intronic
1185379649 22:50502565-50502587 CCCCTGGCCTCACTCTGCAGAGG + Intergenic
949942223 3:9163726-9163748 CCCCAGCCCTGACTGTGCAGAGG - Intronic
950376459 3:12576391-12576413 ACCGGGGCCTGTCGGTGCAGGGG - Intronic
950453150 3:13076869-13076891 CCCCGTTCCAATCTCTGCAGAGG + Intergenic
950466825 3:13160782-13160804 CCCAGGGGGTGTCTGTGCAGTGG - Intergenic
954041007 3:47887344-47887366 ACCCGGGCCAGTGGCTGCAGAGG + Intronic
954794655 3:53155308-53155330 CCCCTGGCATGTCTCTGCTAGGG + Intergenic
955449483 3:59050996-59051018 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
956028352 3:65008327-65008349 ACCATTGCCTGTCTCTGCAGGGG + Intergenic
956167264 3:66406060-66406082 TCCCTGGCCTGTGTCTGCAAGGG - Intronic
957088580 3:75706493-75706515 CCCAGGGGCTGCCTCTGAAGTGG - Intergenic
961195709 3:124999633-124999655 CACAGGCCCTGCCTCTGCAGTGG + Intronic
961592283 3:127990091-127990113 CCCTGGGCTCCTCTCTGCAGTGG - Intergenic
961639517 3:128356360-128356382 CCCAGGGCCTAGCTATGCAGAGG + Intronic
961648058 3:128403196-128403218 CACCTGGCCTGTCTCTGCCTCGG - Intronic
963855219 3:150246500-150246522 CCCTTGTCCTGGCTCTGCAGAGG + Intergenic
965109426 3:164402112-164402134 ACCCGGGCCAGCCGCTGCAGAGG - Intergenic
966696409 3:182793907-182793929 CCCCGCGCCCGTCTCCGCTGCGG - Intronic
968479500 4:826984-827006 CCCCGGGATTTCCTCTGCAGCGG + Intergenic
968628128 4:1637254-1637276 CACGGGGCCTGTGACTGCAGGGG + Intronic
968728521 4:2259242-2259264 CCCAGGGCCTGTTGGTGCAGCGG - Intronic
968975687 4:3821047-3821069 TCCCGAGCCTGTCCCGGCAGTGG - Intergenic
969198687 4:5584511-5584533 CCCCCGTCCTGTCTGTGCTGTGG - Intronic
969470076 4:7382428-7382450 CCCTGGGGCTGTCTCAGGAGGGG - Intronic
969502708 4:7563114-7563136 CCCTGGCCCTCTCTCTGCATTGG + Intronic
971134780 4:23856412-23856434 GCCCGGGCCTCTCTCTGATGGGG - Intronic
974641744 4:64640695-64640717 ACCCGGGCCAGTGGCTGCAGAGG - Intergenic
974670070 4:65018525-65018547 AGCTGGGCCTGTCTCAGCAGTGG - Intergenic
974792769 4:66712636-66712658 ACCCGGGCCAGTGGCTGCAGAGG - Intergenic
976779731 4:88745809-88745831 CTGCTGGCCTGTCCCTGCAGTGG - Intronic
977310067 4:95374706-95374728 CCCTGGGCCTCCCTCTCCAGAGG - Intronic
980013704 4:127623693-127623715 CGCGGGGCCAGTCTCGGCAGCGG - Intronic
982116855 4:152105201-152105223 GCCCCAGCCTGGCTCTGCAGAGG - Intergenic
984937656 4:184903331-184903353 CCACGGTCCTGCCTCTGCTGGGG - Intergenic
985549971 5:528153-528175 CTCAGGGCCTGTGTCTGAAGCGG + Intergenic
985824389 5:2181773-2181795 CCCAGGGCCTGGCACCGCAGGGG + Intergenic
987290722 5:16505750-16505772 CCAGAGGCCTGGCTCTGCAGTGG - Intronic
987876949 5:23691263-23691285 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
988313115 5:29587418-29587440 CCTGGGGCCTGTGTCTGCAAGGG - Intergenic
993647038 5:90474648-90474670 CCCCGGGCGTGTGACAGCAGAGG + Exonic
993873334 5:93277430-93277452 CTGGGGGCCTGTTTCTGCAGTGG - Intergenic
995565958 5:113433455-113433477 CACAGAGCCTGTCTCAGCAGAGG - Exonic
995710758 5:115033148-115033170 TCCAGGTCCCGTCTCTGCAGTGG + Intergenic
995933732 5:117483730-117483752 GCCCCTGCCTGTCTCTGCAGAGG + Intergenic
996560333 5:124821355-124821377 CCCCAGGGTTGTCTCTGAAGTGG - Intergenic
997521301 5:134525943-134525965 TCCCGCGCCGGTCCCTGCAGCGG + Intronic
997588118 5:135056242-135056264 CCCCCGTCTTGGCTCTGCAGAGG + Intronic
997712180 5:136015190-136015212 CCCTGAGCCTGTCTCTGCCTGGG + Intergenic
998219286 5:140263265-140263287 CCACAGGTCTTTCTCTGCAGAGG - Intronic
999280709 5:150363563-150363585 CCCTGGGCCTTTCTGTGTAGGGG + Intronic
1001539914 5:172530576-172530598 CCCTGAGCCTGCCTCTGGAGTGG - Intergenic
1001938828 5:175726998-175727020 ACCTGGCCCTGTCTCTCCAGTGG + Intergenic
1001939133 5:175728687-175728709 CCCAGGCACTGTCTCTGCACTGG + Intergenic
1001960615 5:175878595-175878617 CCCCCGCCCTGCCTGTGCAGAGG + Intronic
1002422448 5:179155679-179155701 CCCAGCTCCTGTCTCAGCAGAGG + Intronic
1003047741 6:2749798-2749820 CCCCTGGCCTCCCTCTGCAGAGG + Intronic
1003070223 6:2939769-2939791 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
1003521319 6:6861056-6861078 CCCCAGGACTGTGTCTGCAGGGG - Intergenic
1004045785 6:12021493-12021515 CCCAGGGCATGTCTGTGGAGGGG - Intronic
1004900308 6:20187456-20187478 CCCAGGGCAAGTCTCTGCTGTGG + Intronic
1005912906 6:30326669-30326691 GCGCGGGCCTGTATCTCCAGAGG + Intronic
1005977004 6:30807663-30807685 ACCCGGGCCAGTGGCTGCAGAGG - Intergenic
1006334478 6:33413389-33413411 CACCTGTCCTGTCTCTGCAGAGG + Exonic
1006477833 6:34269165-34269187 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
1008598435 6:53065677-53065699 ACTCCTGCCTGTCTCTGCAGCGG - Intronic
1010157720 6:72814093-72814115 CCTTGGGCCTGGCTCTGCACTGG - Intronic
1010925453 6:81739882-81739904 GCCAGTGCCTGTCTCTGTAGTGG + Intronic
1011143693 6:84189507-84189529 ACCCGGGCCAGTGGCTGCAGAGG + Intronic
1014550064 6:122779759-122779781 CCCCGCTCCTGTCTCTAAAGAGG + Exonic
1015906426 6:138122060-138122082 CCCAGGGCATCTCTCTGCATAGG + Intergenic
1017724793 6:157269426-157269448 TCCCGAGGCTGTCTCTGCAAGGG + Intergenic
1018028482 6:159823483-159823505 CCCCTGGCCTGGCCCTGCACAGG + Intergenic
1018694912 6:166383347-166383369 CCCAGGGCCTGTGTCTGCGCCGG + Intergenic
1019140534 6:169939678-169939700 CCACAGGACTGTCTCTGCAGCGG - Intergenic
1020481515 7:8668567-8668589 CCTGGAGCCTGTATCTGCAGGGG + Intronic
1022207521 7:28179559-28179581 CCCTGGGGGTGTCTCTCCAGCGG + Intronic
1027185625 7:75968962-75968984 CCGTGGGGCTGTCTCTCCAGGGG + Intronic
1034559686 7:151872088-151872110 GCCCGGGTGTGTCTCAGCAGAGG - Intronic
1034999815 7:155603738-155603760 CCCCAGTCTTGTCACTGCAGCGG + Intergenic
1035261615 7:157665096-157665118 CCCCAGGCCAGGCTGTGCAGGGG - Intronic
1035352470 7:158256314-158256336 CCCCGCGGCTGCCTCTGCTGAGG + Intronic
1035401879 7:158570925-158570947 ACCCGGGCTTTGCTCTGCAGGGG - Intronic
1036620633 8:10422784-10422806 CCCAGGGCCTGCCTCTGCATAGG - Intronic
1036691820 8:10949138-10949160 CCCCGGGGCTGCCTCTGCAGGGG + Intronic
1040481598 8:47832129-47832151 CCCTGGGCCTCCCTCTGGAGGGG - Intronic
1040563049 8:48541477-48541499 CCCGGGGCCTGTGGCTGCACAGG - Intergenic
1042591468 8:70402688-70402710 CCGAGGGCCTGTCCCTTCAGGGG + Intronic
1043701125 8:83290491-83290513 ACCCGGGCCAGTGGCTGCAGAGG + Intergenic
1047207542 8:122815194-122815216 CCACGGGCCAGGCACTGCAGTGG + Intronic
1047512002 8:125522492-125522514 CCCCAGCCCTGTATCTCCAGAGG - Intergenic
1048575641 8:135687728-135687750 CCACGGGTCTGTCTGTCCAGTGG + Intergenic
1049013867 8:139906251-139906273 CACAGGGCCTGTCCCTGCTGTGG - Intronic
1049046540 8:140156557-140156579 GCCATAGCCTGTCTCTGCAGCGG + Intronic
1049281843 8:141753423-141753445 CCCAGGGCCTGTCTCAGCAGGGG - Intergenic
1049407336 8:142457591-142457613 TTCCGGGCCTGCCTCTGCTGTGG + Intronic
1049435153 8:142583149-142583171 CCCTGGGCCTATCTCTCCAGGGG - Intergenic
1049478603 8:142808324-142808346 CCCCTGTCCTGCCTCTGCAGCGG - Intergenic
1049544258 8:143222025-143222047 CCCCTGGCCTGTGTCCCCAGGGG + Intergenic
1049553973 8:143273265-143273287 CCCCAGGCCTGTCTCCACAATGG + Intronic
1049617243 8:143581020-143581042 CCCCACGCCTGACACTGCAGGGG - Intronic
1049736603 8:144210396-144210418 CACAGGGCCTGTTTATGCAGTGG - Intronic
1049747574 8:144269466-144269488 CCTGGAGCCTGTCTTTGCAGAGG - Intronic
1052859317 9:33427153-33427175 CCCTGGGCCTGTTTCAACAGCGG + Intergenic
1053284949 9:36844195-36844217 CCCAAGGCCTGTTTCTACAGAGG + Intronic
1057271622 9:93654771-93654793 CCCCAGCCCAGTCCCTGCAGAGG + Intronic
1060208424 9:121696218-121696240 CCCCTTGCCTCTCTCTGAAGTGG - Intronic
1060594235 9:124838956-124838978 CCCCGGGCCAGCGGCTGCAGAGG - Intergenic
1060759656 9:126236455-126236477 CCCCGGGCCTGGCTGAGCTGGGG - Intergenic
1060770297 9:126327157-126327179 GCCCGGGCCTGTCCCCGCCGCGG - Intronic
1061091339 9:128428282-128428304 CACTCAGCCTGTCTCTGCAGGGG + Exonic
1061386113 9:130290219-130290241 CCCCAGGCCTGGCCCTACAGGGG + Intronic
1061801458 9:133115373-133115395 CCCCGGGCCTGTGTGTGGAAAGG + Intronic
1061808891 9:133151233-133151255 CCGCAGGCCTGTCCCAGCAGGGG - Intergenic
1061968386 9:134029336-134029358 TCAAGGGCCAGTCTCTGCAGGGG + Intergenic
1062085205 9:134644571-134644593 CCCCGCGCCTGCCTCTCCAGTGG - Intronic
1062308182 9:135921340-135921362 CCCCGGGCCTGCCTCCACACAGG + Intergenic
1062676906 9:137752074-137752096 CCCCGGTCCTGTCTCCACATCGG - Intronic
1186194584 X:7098283-7098305 CAGCAGGTCTGTCTCTGCAGAGG + Intronic
1187008075 X:15251291-15251313 TCCCGGGCCTGCCTTTGGAGAGG - Intronic
1192178627 X:68901622-68901644 CCCAGGGCCTGACTCAGGAGGGG + Intergenic
1192809379 X:74535984-74536006 GCCCGGGCCTGTCAGAGCAGCGG + Intergenic
1193144910 X:78066542-78066564 CCCAGGGCCTGTCTCTGTGATGG + Intronic
1194650826 X:96512474-96512496 ACCCGGGCCAGTGGCTGCAGAGG - Intergenic
1195702431 X:107715519-107715541 CCCCAGTCCAGGCTCTGCAGAGG + Intronic
1198267310 X:135021895-135021917 CCCTGGGCCTCACTCTGGAGCGG - Exonic
1199028803 X:142972359-142972381 ACCCGGGCCAGTGGCTGCAGAGG - Intergenic
1200218267 X:154378422-154378444 CCCCGGGCCAGGCGCTGCCGAGG - Intergenic
1201400460 Y:13599165-13599187 CCCCGGGCCTGTGACGGGAGGGG - Intergenic