ID: 916890923

View in Genome Browser
Species Human (GRCh38)
Location 1:169111664-169111686
Sequence ATTGCAGGCAGAGCTCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916890917_916890923 -6 Left 916890917 1:169111647-169111669 CCAGATGTCCTACCCGCATTGCA 0: 1
1: 0
2: 0
3: 0
4: 45
Right 916890923 1:169111664-169111686 ATTGCAGGCAGAGCTCCCACGGG 0: 1
1: 0
2: 3
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916890923 Original CRISPR ATTGCAGGCAGAGCTCCCAC GGG Intronic
900031113 1:373795-373817 ATTCCAGGCAGATCCGCCACTGG + Intergenic
900051682 1:602049-602071 ATTCCAGGCAGATCCGCCACTGG + Intergenic
900712997 1:4126901-4126923 ATAGCTGGAAGAGCTGCCACCGG - Intergenic
901335404 1:8444686-8444708 ATTGCAAGCACAGCACCCAGAGG - Intronic
901848364 1:11999132-11999154 GTGGCAGGCAGTGCTCCCTCGGG - Intronic
903305532 1:22410323-22410345 ACTGCAGGCACAGCTCACACTGG - Intergenic
903467888 1:23564999-23565021 ATTGAGGGCTGAGCACCCACAGG + Intergenic
904374809 1:30073735-30073757 GCTGCAGTCAGAGCTCCCAGTGG + Intergenic
904394937 1:30213780-30213802 GTTGCAGTCAGAGCACCAACAGG - Intergenic
905103021 1:35542045-35542067 TGTGCAGACAAAGCTCCCACTGG + Intronic
905631136 1:39519179-39519201 ATAGCAGGCAGGGCTCCCCAGGG + Intronic
905666622 1:39766992-39767014 ATGGCAGGCAGGGCTCCCCAGGG - Intronic
906975144 1:50561915-50561937 ATTACAGACATAGCTCCCTCAGG + Intronic
912693533 1:111822683-111822705 ATTGAAGGCAGGACTCCAACAGG - Intronic
913247921 1:116886634-116886656 ATGGCATGCAGTGCTCCAACAGG - Intergenic
916890923 1:169111664-169111686 ATTGCAGGCAGAGCTCCCACGGG + Intronic
917132178 1:171754591-171754613 AGTGAAGGCAGAGCTTCCACTGG + Intergenic
918878666 1:190084683-190084705 ACTGCAGTCAGAGCTCCCTCAGG - Intergenic
919086460 1:192926414-192926436 ATTCCAGACAGAGCACACACTGG - Intergenic
919621559 1:199869473-199869495 ATTGCAGGCAGAGGTCCAAGTGG - Intergenic
921029945 1:211327766-211327788 GTGGCAGGCAGAGCTGCCTCAGG + Intronic
1064110564 10:12535158-12535180 AGAGCAGGCAGAGTCCCCACGGG - Intronic
1064450669 10:15439483-15439505 AATGCAGGCAAAGCCCACACCGG + Intergenic
1067236299 10:44453589-44453611 CTTGCTGGCAGAGCTTCCAGGGG - Intergenic
1068934603 10:62623374-62623396 TTTCCAGGCAGAGGTTCCACAGG + Intronic
1069849473 10:71396152-71396174 ACTGCAGACGGAGCTCCCGCAGG + Intergenic
1070546454 10:77456638-77456660 GATGCAGGCAGAGCTGGCACTGG - Intronic
1070705217 10:78632537-78632559 ATTGCAGGGGGAGCTCCAAGGGG - Intergenic
1071554652 10:86592878-86592900 ATTGGAGGTAGAGATACCACTGG - Intergenic
1073425476 10:103452928-103452950 CCTGCAGGCAGAGCTCCAACTGG + Intergenic
1074778911 10:116786184-116786206 ATGGAAGGCAGGGCTCCCAGGGG + Intergenic
1074987727 10:118672322-118672344 ATTGCAGGGAGAGCTCATCCTGG - Intergenic
1076202971 10:128572891-128572913 ATTGCAGGGAAAGCTCCCCGAGG - Intergenic
1077388782 11:2289574-2289596 ATTGTAGGCAGAGCTGCAAGAGG + Intergenic
1079402093 11:20114043-20114065 ACTGCAGGCAGAGGTCACAATGG - Intronic
1079408251 11:20163599-20163621 ATTCCAGGCACGGCTCGCACTGG - Intergenic
1085011680 11:73145701-73145723 TTTCCAGGCAGAGCTACCCCTGG + Intergenic
1086464745 11:87041498-87041520 ATTGCAGGGTGAGATTCCACAGG - Intronic
1086690118 11:89780324-89780346 ACTGCAGGCTGAGGTCCCAAAGG + Intergenic
1086698544 11:89872648-89872670 ACTGCAGGCTGAGGTCCCAAAGG - Intronic
1086715736 11:90059633-90059655 ACTGCAGGCTGAGGTCCCAAAGG - Intergenic
1086866278 11:91983848-91983870 TGTGAAGGCAGAGCTCCCACAGG + Intergenic
1087656483 11:100929283-100929305 ATAGGAGGCAGAGCTCACCCAGG + Intronic
1088858908 11:113781648-113781670 ATTGCAGGCAGAGCAAGCAAAGG - Intergenic
1090258650 11:125303365-125303387 ATTGCTGGCAGAGCCAGCACTGG + Intronic
1092206028 12:6614495-6614517 ATTGCTGGCAGAGCTCTGTCTGG + Intergenic
1092217603 12:6694061-6694083 CTTGGAGGCAGAGCTCCCGATGG + Exonic
1096429462 12:51531244-51531266 CTTGCAGACAGAACTACCACTGG - Intergenic
1102453673 12:113058136-113058158 ATTGCAGGCCCAGCTCCTCCTGG - Exonic
1104491020 12:129193431-129193453 ATTGCAGGCATAGCACCTTCTGG - Intronic
1104850730 12:131872288-131872310 AAGGCAGGCAGAGCCGCCACAGG - Intergenic
1105507727 13:21024553-21024575 TATGCAGGAAGAGCTCCCGCAGG - Intronic
1106106236 13:26735727-26735749 TTCACAGGCAGAGCTTCCACAGG - Intergenic
1113917433 13:113882943-113882965 TGTGCAGGCAGAGCCCCCTCCGG - Intergenic
1115751429 14:36496259-36496281 ATTAAAGGTAGAGCTCCCTCTGG - Intronic
1116923329 14:50605240-50605262 ATTGCAGGCAGAAAATCCACTGG - Intronic
1117061716 14:51970783-51970805 ACTGGAGGCAGTCCTCCCACAGG - Intronic
1118775014 14:68968373-68968395 AGGGATGGCAGAGCTCCCACAGG + Intronic
1119429611 14:74557898-74557920 CTTCCAGGCTGAGCTCCCACTGG - Intronic
1122012093 14:98758710-98758732 ATGGCAGGGAGGACTCCCACAGG - Intergenic
1122481415 14:102049803-102049825 CTTCCAGGCAGAGCTCCTCCAGG - Exonic
1124421512 15:29527107-29527129 AGAGCAGGCTGAGCTGCCACAGG - Intronic
1125190685 15:36989292-36989314 AGTGCAAGCAGAAATCCCACTGG - Intronic
1125677122 15:41508126-41508148 ATGGCAGGCAGAGCTCCAGCTGG - Exonic
1130433617 15:83874270-83874292 ATCCCACGCAGAGCTCCCAGAGG + Intronic
1131558182 15:93417374-93417396 AGGCCAGGCCGAGCTCCCACAGG + Intergenic
1132631994 16:922378-922400 ATGGCAGGCAGAGCGGCCACTGG + Intronic
1134286162 16:12863697-12863719 TTTGGAGGCTGAGCTCACACAGG - Intergenic
1137504506 16:49041396-49041418 CTGGCAGGCAGAGCTGGCACTGG - Intergenic
1137977801 16:53045854-53045876 AATGCAAGCACAGGTCCCACTGG + Intergenic
1139634330 16:68248766-68248788 CTCCCAGGCAGAGCTCCCATCGG + Intronic
1140536470 16:75714433-75714455 GTTGCAGGAACAGCTCCCAATGG - Intronic
1140985813 16:80157066-80157088 AGTGCAGGCAAAGGGCCCACAGG + Intergenic
1143116372 17:4584077-4584099 ATTCCAGGCGAAGGTCCCACAGG + Intronic
1143694574 17:8602472-8602494 ATTGCTGGTAAAGCTCACACCGG - Intronic
1144200247 17:12934595-12934617 ACTGGTGGCAGAGCTTCCACTGG + Intronic
1144700180 17:17332475-17332497 ATTGCTGGCAGGACTCCCAGGGG - Intronic
1146563579 17:33892749-33892771 AATGCAGGCAGTGCTCACACTGG + Intronic
1149638207 17:58186756-58186778 ATTGAGGGAAGAGCTCACACAGG + Intergenic
1152044151 17:77924876-77924898 ATGGCAGGCAGGGTTCCCAGCGG + Intergenic
1152948528 17:83211874-83211896 ATTCCAGGCAGATCCGCCACTGG - Intergenic
1157006279 18:43588850-43588872 AATTCAGGCAAAGCTGCCACTGG - Intergenic
1157577463 18:48753092-48753114 AGGGCAGGCAGAGCTCACTCAGG + Intronic
1162965688 19:14155009-14155031 AATGTAGGCAGTGCTCCCTCAGG + Intronic
1163120479 19:15214258-15214280 TTTGCATGCAGAGTTCCCACTGG + Intergenic
1164558686 19:29273421-29273443 CCTCCAGGCAGAGCTGCCACAGG + Intergenic
1165762368 19:38329154-38329176 ATTGCAGGCTCCGCCCCCACCGG - Intergenic
1167986149 19:53317995-53318017 ATTGAAGGCACAACACCCACTGG - Intergenic
1168113774 19:54209484-54209506 CCTGCAGGGAGAGCTCTCACCGG + Intronic
1168201909 19:54821734-54821756 ATTCCAGGCAGATTTCCCTCTGG + Exonic
932603371 2:73145618-73145640 ACTTCAGGAAGAGCTGCCACTGG - Intronic
933159923 2:79012174-79012196 ATTGCAGGAAGAGCTCTGAGAGG + Intergenic
933252409 2:80043570-80043592 GTTGAATGCAGAGCTCTCACAGG + Intronic
934464448 2:94246971-94246993 ACTGCAGGCACTGCTCCCCCGGG - Intergenic
935663030 2:105486215-105486237 GCTGCAGGCAGAGATCCCTCTGG + Intergenic
939690925 2:145259210-145259232 CTTGAATGCAGAGCTCACACAGG + Intergenic
940422416 2:153495966-153495988 TTGGCAGGCAGAGTTCCTACTGG + Intergenic
941465796 2:165825300-165825322 GTTGAAGGCAGTGCTCCGACTGG + Intergenic
945514978 2:210752398-210752420 AGTGCAGCCAAAGCTCCCTCTGG - Intergenic
946153077 2:217789394-217789416 AGTTAAGGCAGAGCTGCCACGGG - Intergenic
946717888 2:222572322-222572344 AGTGCAGGCAGAGTTCCCCTAGG - Intronic
1170750107 20:19137886-19137908 ATTGCAGGCACAGAGCCCAGTGG - Intergenic
1170916201 20:20628494-20628516 ACAGCAAACAGAGCTCCCACAGG - Intronic
1179141593 21:38730631-38730653 ATTGCAGTCAAAGCTATCACTGG + Intergenic
1181506406 22:23361208-23361230 ACTACAGGCAGAGATCCCTCAGG - Intergenic
1181608969 22:23999954-23999976 AAGGCAGGCAGAGCTGCCATGGG - Intergenic
1183220024 22:36506500-36506522 ATTGCAGTGAGAGTTCCCGCAGG - Intronic
1183769580 22:39912526-39912548 TTTGCAGGGAGAGGTCCTACTGG + Intronic
1185172466 22:49301891-49301913 GTTGCAGACAGAGACCCCACTGG + Intergenic
1185288449 22:50012652-50012674 TGTGCAGTGAGAGCTCCCACTGG + Exonic
950424865 3:12919705-12919727 CTTGCAGCCAGGGTTCCCACAGG + Intronic
951765578 3:26194811-26194833 ATTGCAAGGACAGCTCCAACGGG - Intergenic
956401833 3:68887753-68887775 ATTGAATGCTGAGGTCCCACAGG + Intronic
957035747 3:75290861-75290883 CTTTCAGGCAGAACTCCCACAGG - Intergenic
961304287 3:125945851-125945873 CTTTCAGGCAGAACTCCCACAGG + Intergenic
961674786 3:128558106-128558128 ATTGCGGGCTGAGCTCTCATTGG - Intergenic
962957450 3:140279250-140279272 GCTGCAGGCAGAGCTCCCACTGG + Intronic
966907556 3:184538839-184538861 ACTGGAGGCTGAGCTCTCACTGG + Intronic
967434921 3:189432245-189432267 ATGGCAGGCAGAGGTCCCACTGG - Intergenic
974568288 4:63607624-63607646 TTTGGAGGCAGAGTTGCCACCGG - Intergenic
974900416 4:67989721-67989743 TTTGAAGGCTGAGCTCCTACAGG - Intergenic
979776461 4:124594590-124594612 ATTGCAGGCAAATATCCCTCAGG + Intergenic
980574247 4:134665475-134665497 AATGCAGGCAAAGGTGCCACTGG - Intergenic
984707183 4:182856092-182856114 CCTGCAGGCAGTGCTCCCAAGGG + Intergenic
989098612 5:37804111-37804133 TTTGCAGGTAGACCTACCACTGG - Intergenic
989348137 5:40453291-40453313 CTTGCAGCCAGAGATCCCAGAGG - Intergenic
990335326 5:54766941-54766963 ATTGCCTGCAGCGCTCCCAGTGG - Intergenic
993479472 5:88406340-88406362 TTTTCATGCAGAACTCCCACTGG - Intergenic
994455173 5:99996875-99996897 ATTGCAGGCATATCTCATACTGG + Intergenic
997194509 5:131969408-131969430 GCTGCTGGCAGATCTCCCACAGG + Intronic
999309369 5:150541885-150541907 AATGCAGGGAGAGCTCCCTGAGG - Intronic
999536877 5:152527383-152527405 ATTGCAGCCAGAATTCCCAGTGG + Intergenic
1000575045 5:162966613-162966635 ACCACAGGCAGAGTTCCCACTGG - Intergenic
1000575434 5:162969989-162970011 GCCACAGGCAGAGCTCCCACTGG + Intergenic
1001489496 5:172145473-172145495 ACTGCAGGCAGAGCACGCGCTGG + Intronic
1002343234 5:178530676-178530698 GTTGCAGCCACAGCTCCCTCCGG + Intronic
1002742707 5:181445073-181445095 ATTCCAGGCAGATCCGCCACTGG - Intergenic
1003231905 6:4261838-4261860 ATTGCAGGCAGAGAACCAAAGGG + Intergenic
1004287765 6:14338471-14338493 ATTCTAGGCAGAGCTCACTCAGG + Intergenic
1004766557 6:18734674-18734696 AATGCAGGTAGATTTCCCACAGG - Intergenic
1006785922 6:36667276-36667298 CTGGCCGGCAGAGCTCCCGCTGG - Intergenic
1011671268 6:89685467-89685489 ATGGCTGGCAGTGCTCTCACTGG + Intronic
1013250887 6:108332078-108332100 ATTGCACTCAGAGCAGCCACAGG + Intronic
1013569287 6:111404807-111404829 ATTGCAGGCAGAGCTTTCTCTGG - Intronic
1017549113 6:155485657-155485679 ATTATAGGCAGAGTTCTCACTGG + Intergenic
1017819246 6:158037874-158037896 ATTGCAGCGAGAGTTCTCACAGG - Intronic
1017966269 6:159269772-159269794 CTTGCAGGCAGAGTTACCTCTGG + Intronic
1018302883 6:162422462-162422484 CTTGCATGTAGAGCTCTCACAGG + Intronic
1018629184 6:165807456-165807478 ATTACAACCCGAGCTCCCACAGG + Intronic
1019247842 6:170720812-170720834 ATTCCAGGCAGATCCGCCACTGG - Intergenic
1019288040 7:233519-233541 CGTGCAGGCTGAGCTCCCCCGGG + Intronic
1019353970 7:569521-569543 TTTGTAGGCAAAGCTCCCCCAGG - Intronic
1022476797 7:30716321-30716343 AGTGCAGGCTGAGCACTCACAGG + Intronic
1023301714 7:38780210-38780232 AATGCAGGCAGAGTTCCTAAAGG + Intronic
1023537080 7:41225009-41225031 GTGGCAGGCAGAACACCCACCGG + Intergenic
1023843682 7:44109704-44109726 ATCACAGGTAGAGCTCCCCCAGG - Intronic
1027721273 7:81744543-81744565 ATTGCAGGCAAATCTCCTTCTGG - Intronic
1029453568 7:100655996-100656018 ACTCCAGGCCCAGCTCCCACCGG - Intronic
1030538845 7:110803719-110803741 ATTGCTGGGAGTGCTCCCAGGGG - Intronic
1030950915 7:115789970-115789992 ATTGCGGGAGGAGCTCCAACTGG - Intergenic
1031951213 7:127894242-127894264 ATTGAATGAAGAGCTTCCACTGG + Intronic
1035500275 8:87052-87074 ATTCCAGGCAGATCCGCCACTGG + Intergenic
1036607070 8:10316925-10316947 ATTGCTGGGAGAGCTCACCCAGG - Intronic
1040886190 8:52266495-52266517 ATGGCAGGCAGATCTCACAGGGG + Intronic
1044188005 8:89279554-89279576 TTTGCAAGCAAAGCCCCCACAGG - Intergenic
1046396219 8:113643384-113643406 ATTGAAGGCAATGCTACCACAGG + Intergenic
1046746945 8:117886367-117886389 ATTTCTAGTAGAGCTCCCACTGG - Intronic
1056852712 9:90097695-90097717 GTTGCAGGCTGAGCTCCGAGAGG + Intergenic
1056891181 9:90494390-90494412 ATTTGAGGCTGAGCTTCCACTGG + Intergenic
1057570111 9:96197926-96197948 AATGCAGGCAGAGCTCCTAAGGG + Intergenic
1060186625 9:121567728-121567750 AATGCATGCAGAGCTTCCAGTGG - Intronic
1060822247 9:126668209-126668231 ATTGCAGGGAAAGATCCCTCTGG + Intronic
1061590507 9:131594717-131594739 AAATCAGGCAAAGCTCCCACCGG + Intronic
1061623863 9:131828986-131829008 ATTTCAGGGGCAGCTCCCACTGG - Intergenic
1061931225 9:133834154-133834176 AGTGCAGGCAGAGCTGGCCCTGG - Intronic
1062269983 9:135703940-135703962 ACTGCAGGCAGAGCAGCCGCCGG + Intronic
1203608613 Un_KI270748v1:76292-76314 ATTCCAGGCAGATCCGCCACTGG - Intergenic
1185711179 X:2304522-2304544 ATTGCAAGCACAGCACCCAGGGG - Intronic
1191260556 X:58315068-58315090 AATGCAGGCACACCTCTCACAGG + Intergenic
1192055624 X:67770025-67770047 CTTGGAGGCAGAGCTCCCACAGG + Intergenic
1193593546 X:83419395-83419417 ATTGCAGGCAGAGCCTTGACGGG + Intergenic
1194248061 X:91538790-91538812 ATTGCAGACAGAGCTTTGACAGG + Intergenic
1198413390 X:136394395-136394417 GTTCCAGGCAGAGTTTCCACAGG - Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200567076 Y:4780319-4780341 ATTGCAGACAGAGCTTTGACAGG + Intergenic