ID: 916894187

View in Genome Browser
Species Human (GRCh38)
Location 1:169144549-169144571
Sequence GCTAGGAGATTGATCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916894187_916894189 18 Left 916894187 1:169144549-169144571 CCAGGAAGGATCAATCTCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 916894189 1:169144590-169144612 ATTTCGATAACAATTTTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916894187 Original CRISPR GCTAGGAGATTGATCCTTCC TGG (reversed) Intronic
900857257 1:5196132-5196154 GCCAGGACATGGATTCTTCCCGG - Intergenic
902210580 1:14901681-14901703 GCTAGCAGATGGGTCCATCCAGG + Intronic
903230901 1:21921813-21921835 GATAGCAGGTTGAGCCTTCCTGG - Intronic
915843199 1:159233694-159233716 GCTAGGAGATGGATACACCCTGG + Intergenic
916894177 1:169144495-169144517 GCTAGGAGGTTGATCCTTATTGG - Intronic
916894187 1:169144549-169144571 GCTAGGAGATTGATCCTTCCTGG - Intronic
916925155 1:169511493-169511515 CCTAGTAAATTGTTCCTTCCTGG + Intergenic
917606455 1:176635661-176635683 GCTTGGAAATTAATTCTTCCTGG + Intronic
918844495 1:189592190-189592212 CCTAGGACATTGGTTCTTCCTGG - Intergenic
920746586 1:208634838-208634860 GCTGGGACATTGATCTTTCCTGG + Intergenic
920957636 1:210633720-210633742 GCTGGCAGATTGAGGCTTCCGGG + Intronic
921330980 1:214035716-214035738 GCAAAGATGTTGATCCTTCCTGG + Exonic
1063027206 10:2192194-2192216 GTCAGGAGATTGAACCATCCTGG - Intergenic
1066295407 10:34049811-34049833 GCTAGGAAATTCTTCCCTCCAGG + Intergenic
1071803822 10:89094576-89094598 GCCAGGAGTTTGAGCCATCCTGG + Intergenic
1074688418 10:115980665-115980687 CCTAGGAGATTGTATCTTCCTGG + Intergenic
1077220478 11:1413383-1413405 GGTAGGAGACTCATCCTTCTTGG + Intronic
1081649467 11:44813957-44813979 CCTTGGAGATAGATCCTTCAGGG + Intronic
1082008309 11:47433471-47433493 TCTAGGAGAATGCTCTTTCCAGG + Intergenic
1085604011 11:77881168-77881190 GCTAGGAGAAATATTCTTCCAGG - Intronic
1087968952 11:104455176-104455198 GACAGGAGATTCATCCTTCATGG - Intergenic
1088510446 11:110567745-110567767 GCTAGGAGTTCGAGACTTCCTGG - Intergenic
1096117890 12:49066367-49066389 GCTCGGATATAGATCCTGCCTGG - Intronic
1097767212 12:63539710-63539732 GCTAGGACATTGGTCTTTTCTGG - Intergenic
1097783556 12:63734653-63734675 GCTAGGACATTGGTCTTTTCTGG - Intergenic
1100946007 12:99784540-99784562 GCTAGGAGTTAGATCCTGCCAGG - Intronic
1101919071 12:108918194-108918216 GCTAGGGCATTGATACTGCCTGG - Intronic
1102198033 12:111038070-111038092 GCCAGGAGATTGAGTGTTCCCGG - Intronic
1102533161 12:113561676-113561698 GGCAGGAGATTGTTCCTCCCTGG + Intergenic
1107257364 13:38444505-38444527 TCTAGGAGTTTGATCATTCTTGG - Intergenic
1113024936 13:105929890-105929912 GCTGGGAGATGCTTCCTTCCTGG + Intergenic
1113042229 13:106116874-106116896 GCTAGGAGACTGTTCATTACAGG - Intergenic
1115890556 14:38022879-38022901 GTTAGGATATTGGTGCTTCCTGG + Intronic
1119783551 14:77295804-77295826 GCTAGGCAATTGAGCCTTCCAGG + Intronic
1126623312 15:50662140-50662162 GTCAGGAGATTGAACCATCCTGG + Intronic
1126989864 15:54362182-54362204 CCCAGGTGATTGAGCCTTCCTGG + Intronic
1134013648 16:10873553-10873575 GCTGGGAGCTTGCTCCCTCCCGG - Intergenic
1147052149 17:37803323-37803345 GCTAGGAGGTTGATATTCCCAGG - Intergenic
1153041535 18:816959-816981 GCTACCAGATTGCTACTTCCTGG + Intergenic
1158395803 18:57077600-57077622 GCTCTGCGATTGATCCTTTCAGG - Intergenic
1160317632 18:77862326-77862348 GATAGAAGAATGATCCATCCTGG + Intergenic
1166936715 19:46338114-46338136 GCAGGGAGATTCATCCATCCTGG + Intronic
1167568320 19:50271251-50271273 AATAAGAGTTTGATCCTTCCCGG + Intronic
927291509 2:21409020-21409042 GGTAGGAGATAGTTCCTTCCAGG + Intergenic
928310660 2:30206990-30207012 GCTGAGAGATGGAGCCTTCCAGG + Intergenic
938184229 2:129214412-129214434 CCTAGGAGATTGCTGCATCCCGG + Intergenic
942853527 2:180519452-180519474 GCTAGGAGAATGATTCATCAAGG - Intergenic
1169988707 20:11474814-11474836 AGTAGGCGATTAATCCTTCCAGG - Intergenic
1172770663 20:37380684-37380706 GCATGGAGATGGATCCTGCCTGG + Intronic
1174146972 20:48458978-48459000 GCTGGGAAATTAATGCTTCCAGG - Intergenic
1182670908 22:31995095-31995117 GCTGGGAATTTGATCCTTTCGGG + Intergenic
958924631 3:100144538-100144560 GGTAGGAGATGGAGCCTTCAGGG + Intronic
960444171 3:117727306-117727328 GCTATGACATTGATATTTCCAGG + Intergenic
964781976 3:160349543-160349565 GCTAGGGTATAGATCATTCCTGG + Intronic
965189463 3:165509283-165509305 GCTGGGACATTGATCTTTTCTGG + Intergenic
968597652 4:1493581-1493603 GCCAGGAGGTTGCTTCTTCCAGG + Intergenic
972947934 4:44281008-44281030 GCTAGGAGATTAAAAATTCCTGG + Intronic
975335439 4:73170363-73170385 AGTAGGTGATGGATCCTTCCAGG - Intronic
976519632 4:86011429-86011451 GCAAGTAGATTCATCCTTCTAGG + Intergenic
976636857 4:87294919-87294941 CCTACGAGATTGATCATTCACGG - Intergenic
983919404 4:173329638-173329660 GATTTGAGATGGATCCTTCCTGG - Intergenic
988285319 5:29208165-29208187 ACTAGGAGAATGAATCTTCCAGG - Intergenic
988349878 5:30088287-30088309 ACTAGGAAATAGATCCTGCCCGG + Intergenic
997736462 5:136216065-136216087 GCAAGGAGACTGAGCCTCCCTGG + Intronic
999684249 5:154088366-154088388 GCTAGGAGAATTGTCCGTCCTGG + Intronic
1001711538 5:173782514-173782536 GCTGGGAGAATGATCACTCCTGG - Intergenic
1006320390 6:33316305-33316327 GCTGGGAGATTGATTCTCACTGG + Exonic
1007102524 6:39259534-39259556 GCCAGGAGTTTGAGACTTCCTGG - Intergenic
1008155283 6:48006725-48006747 TTTAGGAAATTGAGCCTTCCTGG - Intronic
1013646721 6:112149793-112149815 GCCAGGAGAGTGGTCCTTCATGG - Intronic
1015175982 6:130309654-130309676 GCCAGGAAATTCATCCTTCTTGG - Intronic
1015237898 6:130991968-130991990 CCTAGGAGAGTGATACTTCCTGG + Intronic
1015454686 6:133413148-133413170 GCTAGGCCATTAATCCTGCCTGG + Intronic
1016369820 6:143361871-143361893 GCAAGCAGATTGCTCCCTCCGGG + Intergenic
1021657746 7:22889062-22889084 GCCAGGAGTTGGATCCTCCCTGG - Intergenic
1030133481 7:106223060-106223082 GCTAGGGGTTTGTTCCCTCCTGG + Intergenic
1031662460 7:124442990-124443012 GCTAGGAGTTTGGTCTTTCTGGG + Intergenic
1033216255 7:139495713-139495735 TCTAAGAGATTGGTCCTCCCAGG + Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1039640806 8:39218971-39218993 AGTAGGTGATTGATCCTTCCCGG + Intronic
1041123317 8:54609153-54609175 GCCAGGAGACTGTTCTTTCCTGG - Intergenic
1044527014 8:93263696-93263718 ATTAGGAGATTGAACCTTCCAGG + Intergenic
1045636356 8:104195722-104195744 GCCAGGAGTTTGAGCCATCCTGG - Intronic
1051704304 9:19860382-19860404 GTTAGGTGATTAATCCTGCCAGG - Intergenic
1052162110 9:25275515-25275537 GAAAAGAGTTTGATCCTTCCGGG - Intergenic
1060930627 9:127487446-127487468 GCTGGGAGAGAGATGCTTCCAGG - Intronic
1186624940 X:11283379-11283401 GGTAGGAGATTGGTCCTGACTGG + Intronic
1188680637 X:32999564-32999586 GTCAGGAGATTGAGCCATCCTGG + Intronic
1189674381 X:43445646-43445668 GCTGGGAGCTTGAATCTTCCTGG - Intergenic
1191048823 X:56169132-56169154 ACCAGGAGATGGATCCTGCCAGG - Intergenic
1192585017 X:72312648-72312670 GCAAGGTGCTGGATCCTTCCCGG + Intergenic
1196745310 X:119066500-119066522 GCTAGGAAAAAGATTCTTCCAGG - Intergenic
1197623564 X:128779241-128779263 AGTAGGTGATTGATCCTGCCAGG + Intergenic
1198560580 X:137845803-137845825 GCTATCATATTGCTCCTTCCAGG - Intergenic
1201917247 Y:19195556-19195578 GTCAGGAGATTGAACCATCCTGG + Intergenic