ID: 916898976

View in Genome Browser
Species Human (GRCh38)
Location 1:169200487-169200509
Sequence TATTATCTCTAGAAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 397}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916898976_916898984 22 Left 916898976 1:169200487-169200509 CCAGCCATCTTCTAGAGATAATA 0: 1
1: 0
2: 0
3: 31
4: 397
Right 916898984 1:169200532-169200554 CTTTCATATGCAAACCAACCAGG 0: 1
1: 1
2: 2
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916898976 Original CRISPR TATTATCTCTAGAAGATGGC TGG (reversed) Intronic
900800992 1:4736994-4737016 ATTTTTCTCTAGATGATGGCTGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906347262 1:45024949-45024971 TAAAATTTCTAGAGGATGGCCGG - Intronic
906925050 1:50106538-50106560 TATTATCTCAAGAATCAGGCAGG - Intronic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910079740 1:83327440-83327462 TAGTTTCTCTAGAAAATGTCTGG + Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912161184 1:106986988-106987010 TACTATCTCTAGGAATTGGCTGG - Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
913260880 1:116996842-116996864 TATCATGGCTAGAAAATGGCGGG - Intergenic
916491190 1:165303898-165303920 TATTATATCTAGTATATGGGTGG + Intronic
916898976 1:169200487-169200509 TATTATCTCTAGAAGATGGCTGG - Intronic
916899770 1:169208435-169208457 TATTATCTCTGTAACATGTCAGG + Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919309216 1:195885647-195885669 TTATATCTCTAGAAGAAAGCTGG - Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920711756 1:208302085-208302107 TGTTATCTCTAGAAGCAGGCAGG - Intergenic
921524243 1:216197483-216197505 TATTATTTGTCCAAGATGGCTGG + Intronic
923394383 1:233546272-233546294 TCTTCTCTCTAAAAGATGTCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063779098 10:9300471-9300493 TATTATCTCTACTTGATAGCCGG - Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065448736 10:25831678-25831700 TATTACCTCTGGAAGTTGTCTGG + Intergenic
1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG + Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071097841 10:81999511-81999533 TATTTTCTCTAGGAGAGGTCAGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071736979 10:88311905-88311927 TCTTATCTCTTGCAGATAGCAGG + Intronic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072098055 10:92201665-92201687 TATTATCTCAAGAAGTTTACTGG + Intronic
1072360467 10:94654141-94654163 AATTGTCTACAGAAGATGGCAGG - Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074761848 10:116672752-116672774 TCTTATTTGTAGAATATGGCTGG + Exonic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081410747 11:42755413-42755435 TATTATCTCAAGAAGAAGCATGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085532581 11:77200821-77200843 TGTTATCACTTGAAGATGGTGGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1087718024 11:101631788-101631810 TATTCTCTGTAGAAAAAGGCAGG + Intronic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1091897334 12:4116101-4116123 ATTTATCTCTATAAGATGCCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092280551 12:7094961-7094983 ATTTATCTCTAAAAAATGGCAGG - Exonic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092942602 12:13424333-13424355 TATTATCTCTAGAAGATACTGGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093225964 12:16483932-16483954 TTTTATGCCTAGAATATGGCTGG - Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097693370 12:62754938-62754960 TGTTATCTTTACAAGATGGGTGG + Intronic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099416242 12:82390536-82390558 TCTTATCTCTAGAAGAAGATCGG + Intronic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099590746 12:84585880-84585902 TATTATTTCTTGCAGATGACAGG + Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101752278 12:107591719-107591741 TTATATCTCCACAAGATGGCAGG + Intronic
1102064669 12:109964011-109964033 TAATATCTCTAGCACGTGGCAGG - Intronic
1102221702 12:111199143-111199165 TATTATTTCTGGACGTTGGCGGG + Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104832239 12:131761302-131761324 TATTTGCTATGGAAGATGGCGGG + Intronic
1105568474 13:21575967-21575989 TTTTATCTCTGTAAGATGGTTGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106185700 13:27407951-27407973 TTTTTTCTCTAGAAGAGGGGAGG + Intergenic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108410290 13:50139052-50139074 CATTATCTCTGGGTGATGGCAGG - Intronic
1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG + Intergenic
1110100464 13:71595133-71595155 GAGGATCTCAAGAAGATGGCTGG + Intronic
1110139469 13:72110047-72110069 TTTTCTCTCCAGAAGATGACAGG - Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG + Intergenic
1115749465 14:36474582-36474604 TATTATTTCTACAAGATGTATGG + Intronic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1118917211 14:70117673-70117695 TACTATCACTAGAAATTGGCTGG - Intronic
1119415933 14:74469128-74469150 TTTGGTGTCTAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1121269254 14:92626968-92626990 TATTTTGGCAAGAAGATGGCAGG + Intronic
1125875447 15:43140259-43140281 TATTATTGCAAGAACATGGCCGG + Intronic
1126333748 15:47564230-47564252 TCTTCTCTCAAGAAGATGGCGGG - Intronic
1127208910 15:56750798-56750820 TAATATTTCTAGAAGAAAGCAGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1130097782 15:80868726-80868748 TATTATCTCTAGTTTATGGATGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130622487 15:85478049-85478071 TAAACTCTCTAGAAGATGGGGGG - Intronic
1131392127 15:92058203-92058225 TAGCATCTCTAGAAGGTGGAGGG + Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133732017 16:8586153-8586175 TACTACCTCTAGAAGGAGGCTGG + Intronic
1135508828 16:23063459-23063481 TAAAATCTATAGAAAATGGCAGG + Exonic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137315161 16:47311526-47311548 TTTTATCTCTACAATATGGTAGG + Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140347312 16:74226805-74226827 TATTTTCTCCACAAGAGGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142882357 17:2891583-2891605 TACTATCACTAGAGGATGGGGGG - Intronic
1143842707 17:9745659-9745681 TATTATCTCTGGAAGACTGGAGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1150140302 17:62722730-62722752 CATTTTCTACAGAAGATGGCTGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153225006 18:2893178-2893200 TATTATCTGTAGAATCAGGCTGG + Intronic
1153572773 18:6489668-6489690 TATTATATCTAGACAATGCCTGG - Intergenic
1153994324 18:10426560-10426582 AATTCTCTCTATAAGATAGCTGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1158562651 18:58528233-58528255 TATTATCTTAAGGACATGGCTGG + Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1163417643 19:17196083-17196105 TATTATCGATAGATGATGGATGG + Intronic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1167906203 19:52662855-52662877 TTTTTTCTCTAGAAAATTGCAGG + Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1168685040 19:58344070-58344092 TTTTATCTTTAAAATATGGCTGG + Intergenic
925419060 2:3696263-3696285 TATTTTCTGTAGGAGTTGGCGGG + Exonic
926713711 2:15906158-15906180 GATTATCTCTAGTAGATGGGAGG + Intergenic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940073715 2:149717977-149717999 TTTTATCTCTAAAAAATTGCTGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942022196 2:171877158-171877180 TATTGTCTATAAAAGATGGCAGG + Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943619332 2:190130657-190130679 TAATATCTATAGAAAATGACTGG + Intronic
943756564 2:191563227-191563249 TATTGTGTCAAGAAGATAGCAGG - Intergenic
944956470 2:204817052-204817074 TTTTATCTCTAGAAGTTTGTTGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945580126 2:211583225-211583247 TATTATTTTTAGAATATGGCTGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946899600 2:224359458-224359480 TACTATCTCTAGAAATTGGCTGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947589208 2:231375608-231375630 AATTCTCCCTAGAAGATGGATGG - Intergenic
1172561668 20:35894245-35894267 TGTTATTTCTGGAACATGGCTGG - Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178029957 21:28513355-28513377 TATTATCTCTATAAACTGGTAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1183675121 22:39294867-39294889 AATGGCCTCTAGAAGATGGCTGG + Intergenic
1184480900 22:44746257-44746279 TCTTAGCTCAAGAAGCTGGCAGG + Intronic
1184572675 22:45336206-45336228 TGTCATCTCTAGTGGATGGCAGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951705274 3:25538014-25538036 TATTATCTCTGGAAGTTTTCAGG + Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954525719 3:51269255-51269277 TATGACCACTAGAAGATGTCAGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956429614 3:69172604-69172626 TAATATATTTAGAAGGTGGCAGG + Intronic
956440839 3:69278971-69278993 TAATATTTCTAAAAGATGTCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957387273 3:79512585-79512607 AATTATCTCTAGGATATGTCTGG - Intronic
957408810 3:79809459-79809481 TACAATATCTAGAAGATGGCAGG - Intergenic
957633789 3:82755235-82755257 TATTAACACTAGAAGATGTGTGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959710365 3:109379713-109379735 TCTTCTCACCAGAAGATGGCTGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
962122559 3:132577655-132577677 GATTATCTCTAAAACTTGGCAGG - Intronic
963774809 3:149427966-149427988 AATTCTATATAGAAGATGGCAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965779613 3:172270768-172270790 TATTATCTATAAAAGATGTCTGG - Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
967822515 3:193851359-193851381 TATTATCTCTTGTAGATGTGAGG + Intergenic
969042578 4:4311660-4311682 TATTATCTCAAGAAAATAGGTGG + Intronic
971194872 4:24463011-24463033 AAAAATCTCTAGAAGTTGGCGGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972729358 4:41778072-41778094 TATGATCTCTAAATGAAGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973764036 4:54147803-54147825 AATTATCAATAGAAAATGGCAGG - Intronic
974008875 4:56588725-56588747 TAAAAATTCTAGAAGATGGCTGG - Intronic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
975399017 4:73913009-73913031 TATGATGTATAGATGATGGCTGG + Intergenic
976440898 4:85073275-85073297 AATTATTTCTAGAAGATAGTTGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978414390 4:108459950-108459972 TATTGACTCAAGAAGATGGTGGG - Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979630030 4:122890503-122890525 TCTTATCTCTAGAAGATTACAGG + Intronic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
981735717 4:147948214-147948236 TATTATCTTTAAAAAGTGGCAGG - Intronic
981873532 4:149515163-149515185 AGTTATCTCCAAAAGATGGCAGG - Intergenic
982362807 4:154540097-154540119 CATTATCTCAAGAAGATAACTGG + Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984645786 4:182218316-182218338 AAATATCTCTAGAAGATTACGGG - Intronic
985239320 4:187913246-187913268 TATTTTCTCTATAACAAGGCAGG + Intergenic
985959425 5:3288710-3288732 TTTTATCTCTAGAAGTTGTGTGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987006431 5:13714991-13715013 TATTATGTTTAGAAGATACCAGG + Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987691392 5:21271401-21271423 TTTTATTGCTAGAAGGTGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
989074967 5:37554977-37554999 TATTCACTCTAAGAGATGGCTGG - Intronic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989288333 5:39730380-39730402 TTTTATCTCTAGAAACTGACTGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990408233 5:55513574-55513596 TATTAACTCTTGAAGAAAGCTGG + Intronic
991031362 5:62085465-62085487 TATTACCTCTATGAGATGGTAGG - Intergenic
991748984 5:69778737-69778759 TTTTATTGCTAGAAGGTGGCAGG - Intergenic
991800565 5:70358548-70358570 TTTTATTGCTAGAAGGTGGCAGG - Intergenic
991828035 5:70651493-70651515 TTTTATTGCTAGAAGGTGGCAGG + Intergenic
991892922 5:71357988-71358010 TTTTATTGCTAGAAGGTGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992353630 5:75956569-75956591 TATCATCTCTTGTAGATGGAGGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994797971 5:104331042-104331064 TAAAATTTCTAGAAGATGGATGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997431045 5:133841473-133841495 TATTATTTCTAGAAGAACTCGGG - Intergenic
997822172 5:137076019-137076041 CATCCTCTCTAGGAGATGGCTGG + Intronic
998996071 5:147870289-147870311 TATTATTACTATAAGAAGGCAGG - Intergenic
999935404 5:156480696-156480718 CATTATCTCCAGAAGAGAGCAGG - Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000718647 5:164678939-164678961 TATGATCTCTGGATAATGGCTGG + Intergenic
1000931654 5:167259305-167259327 TATAATCTGTAGAAGATAGGTGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001959073 5:175869366-175869388 CTCTATCTCTGGAAGATGGCAGG - Intronic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005088953 6:22036263-22036285 GATTATCTCAAGGAGCTGGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005493060 6:26364385-26364407 TATTAGCTCTAGGAGATTTCTGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006475613 6:34250895-34250917 TTTCATCTCTAGAAGATCACTGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008335062 6:50293407-50293429 AATACTCTCTAGAAGAAGGCGGG + Intergenic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008722495 6:54373366-54373388 GATAATCTGTAGAAGATGCCAGG - Intronic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010046040 6:71445050-71445072 TATTTTTTCTCGAAGATGACAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011619068 6:89225075-89225097 TAAAAATTCTAGAAGATGGCTGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012918327 6:105195172-105195194 TATTTTGTCTTGAAGATGGAAGG + Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1012964129 6:105655322-105655344 AGTTATCCATAGAAGATGGCAGG - Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014927116 6:127285917-127285939 TATTGTATCTGGAACATGGCAGG + Intronic
1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016048281 6:139503291-139503313 TAATATCTCTAAAAAATGTCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016541005 6:145164148-145164170 TATTCTCTCTAAAAGAAGGAGGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020543801 7:9496836-9496858 TATTATTTCTACCATATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021885937 7:25139282-25139304 TATTATTTCTGGATGATGGATGG + Intronic
1021974256 7:25996522-25996544 TATTGTCCTGAGAAGATGGCTGG - Intergenic
1022873893 7:34507931-34507953 CATTCTCTCTAGAAGATGAAAGG + Intergenic
1022981732 7:35610785-35610807 TATGAGCTCAAGAACATGGCTGG - Intergenic
1023035444 7:36127448-36127470 CATGAGCTCTAGAAGAAGGCTGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1027297505 7:76792718-76792740 TAGTTTCTCTAGAAAATGCCTGG + Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030072405 7:105709421-105709443 TACTATCTCTAGGAATTGGCTGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1031752213 7:125590324-125590346 TATTATCTTTCAAAGCTGGCAGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038805302 8:30785323-30785345 TATAATCTCAAGAATTTGGCAGG + Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043822448 8:84884460-84884482 TTTTTTCTCTAGAAGATCTCTGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046303463 8:112329423-112329445 TATTTTTTCTAGAAGGTGGGGGG - Intronic
1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG + Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052060786 9:23958704-23958726 TATACTCTCAAGATGATGGCAGG - Intergenic
1054786577 9:69216069-69216091 AGTTATCACTAGAAGCTGGCCGG - Intronic
1054887481 9:70214382-70214404 TATTATTCCTGGAATATGGCAGG - Intronic
1055344380 9:75319294-75319316 TATTACCTATATAAGATGGGTGG - Intergenic
1055520764 9:77078920-77078942 TATAACCTCAAGAAAATGGCAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057689948 9:97275078-97275100 TAAAATCTCTGGAAGAGGGCAGG - Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191100705 X:56724350-56724372 TAAAAATTCTAGAAGATGGCTGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192571077 X:72205487-72205509 TATGAACTCTAGAAGATCTCTGG - Exonic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197000064 X:121430240-121430262 AATTCTCTCTACAAGATGGAAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200106077 X:153713486-153713508 TATTCTTTCTAGAGCATGGCTGG + Intronic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic