ID: 916899345

View in Genome Browser
Species Human (GRCh38)
Location 1:169203615-169203637
Sequence GGCCAGAACCATTCTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 2, 1: 9, 2: 29, 3: 54, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916899340_916899345 3 Left 916899340 1:169203589-169203611 CCCTCTGTGCTCAGTCTCCGTAG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 916899345 1:169203615-169203637 GGCCAGAACCATTCTGTGGTTGG 0: 2
1: 9
2: 29
3: 54
4: 205
916899341_916899345 2 Left 916899341 1:169203590-169203612 CCTCTGTGCTCAGTCTCCGTAGA 0: 1
1: 0
2: 0
3: 27
4: 164
Right 916899345 1:169203615-169203637 GGCCAGAACCATTCTGTGGTTGG 0: 2
1: 9
2: 29
3: 54
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916899345 Original CRISPR GGCCAGAACCATTCTGTGGT TGG Intronic
900945754 1:5830584-5830606 GCCCAGGACCTTTCTGTGGCTGG - Intergenic
900983514 1:6059936-6059958 GGCGGGGCCCATTCTGTGGTTGG - Intronic
901192795 1:7422478-7422500 GGCCAGACCCCCTCTGTGCTGGG + Intronic
901598860 1:10406841-10406863 GTCCAGAACCATTCTGTGCCTGG + Intronic
902498368 1:16890791-16890813 GGCCAGAATCATTCCTGGGTCGG + Intronic
905467482 1:38166413-38166435 CGCCAGAACCTTTCTGTGCCAGG - Intergenic
905672566 1:39801749-39801771 GGCCAGAACCAGTCCGTGGTCGG - Intergenic
908469016 1:64423762-64423784 GGCCAGAACCATTCTGTCATTGG - Intergenic
909224089 1:72994029-72994051 AGCCAGAACCACTCCATGGTTGG + Intergenic
911024328 1:93421091-93421113 GGACATAAACATTTTGTGGTTGG + Intergenic
911686712 1:100785884-100785906 GGCCAGAACCATTCTGTGGTTGG + Intergenic
912226563 1:107740911-107740933 GGCCAGCAACATTTTGTTGTAGG - Intronic
913644416 1:120843175-120843197 GGCCAGAATCATTCCTAGGTCGG - Intergenic
914006191 1:143734524-143734546 GGCCAGAATCATTCCTAGGTCGG - Intergenic
914082318 1:144420403-144420425 GGCCAGAATCATTCCTAGGTCGG + Intergenic
914098783 1:144566425-144566447 GGCCAGAATCATTCCTAGGTCGG - Intergenic
914177222 1:145288902-145288924 GGCCAGAATCATTCCTAGGTCGG + Intergenic
914300201 1:146371241-146371263 GGCCAGAATCATTCCTAGGTCGG + Intergenic
914531951 1:148530395-148530417 GGCCAGAATCATTCCTAGGTCGG + Intergenic
914636441 1:149557338-149557360 GGCCAGAATCATTCCTAGGTCGG - Intergenic
914920920 1:151847072-151847094 GCCCAGGGCCTTTCTGTGGTTGG - Intergenic
915059546 1:153169582-153169604 GGCCAGAACCACTTTGTGGTTGG - Intergenic
916899345 1:169203615-169203637 GGCCAGAACCATTCTGTGGTTGG + Intronic
920445572 1:206013648-206013670 TGCCAGAAGCTTACTGTGGTTGG - Intronic
920452062 1:206066934-206066956 AGCCAGAGCCAGTCAGTGGTTGG + Intronic
920594140 1:207251464-207251486 GTTCAGAACCATTCTGTGTTTGG - Intergenic
920951325 1:210574272-210574294 GGCCAGGAGCCTTCTGTGGCTGG + Intronic
922074877 1:222233667-222233689 GGCCAGAACCACTCCATGGATGG - Intergenic
922155855 1:223039245-223039267 GGCCTGACATATTCTGTGGTCGG + Intergenic
922545082 1:226450639-226450661 GGCCAAGACCACTCTGTGGTTGG - Intergenic
923130059 1:231067273-231067295 GGCCAGAGCCAATCCATGGTAGG + Intergenic
924127590 1:240871471-240871493 TGTCAGCATCATTCTGTGGTTGG - Intronic
924276504 1:242392714-242392736 GGCCAGAAGCCTTCAGTGGGTGG + Intronic
1063280948 10:4628597-4628619 GGCCACACTCATTCAGTGGTGGG + Intergenic
1063588929 10:7377820-7377842 GACCAGTACCAATCTGTGGCCGG + Intronic
1066696760 10:38085828-38085850 AGCCAGAACCAGTTTATGGTGGG + Intergenic
1067110880 10:43398953-43398975 GGCTGGAACTATTCTGAGGTAGG - Intronic
1070047983 10:72858393-72858415 GGCCAGAACCACTCCACGGTCGG + Intronic
1070972664 10:80580400-80580422 GGCCAGAACTACTCTGTGGTCGG + Intronic
1071378809 10:85036980-85037002 GTCCAGAACTAGTCTGTGGTTGG - Intergenic
1071417781 10:85457326-85457348 AGCCAGAACAACTCCGTGGTGGG + Intergenic
1073308841 10:102525034-102525056 AGTCAGAACCCTTCTGTGGGAGG + Intronic
1074536236 10:114330233-114330255 GTCCAGAGCCATTCTGGGGCTGG + Intronic
1076638316 10:131897791-131897813 GGCCAGAACCAGTCCAAGGTCGG - Intergenic
1078074931 11:8149911-8149933 AGCCAGAACCATTCTGTGGTTGG - Intronic
1080426596 11:32160436-32160458 AGCCAGAACCAGTCCATGGTTGG + Intergenic
1080792467 11:35534360-35534382 CTCCAGAACCCTTCTTTGGTTGG + Intergenic
1080962125 11:37172917-37172939 AGCCAGAACCACTCAGTGGTAGG + Intergenic
1081106572 11:39078238-39078260 TGCCTGAACCATGCTGTGTTTGG - Intergenic
1081199239 11:40196367-40196389 AGCCAGAACCATTCTGGACTAGG + Intronic
1081334555 11:41848602-41848624 GGCCAGAACCAGTCCTTGGTTGG - Intergenic
1081983772 11:47286893-47286915 CTCCATAACCATTCTCTGGTGGG - Intronic
1083552323 11:63599208-63599230 GGCCAGAACCAGCCTCTGATGGG - Intronic
1085251413 11:75146398-75146420 GGCCAGAACCCATCCATGGTCGG - Intronic
1086004609 11:82023527-82023549 GGCAAGACCAATTCTGTTGTGGG + Intergenic
1087345728 11:96968713-96968735 GGCCAGAACCACTCCATGGTTGG + Intergenic
1088194266 11:107258108-107258130 GGCCAGAACCACACCATGGTCGG + Intergenic
1090541546 11:127711727-127711749 GGCCAGAACCCCTCCATGGTCGG - Intergenic
1092128596 12:6092705-6092727 AGCCAGAACCATTCCGTGGTTGG - Intronic
1093098555 12:14999895-14999917 AGCCTGAATCATTCTGAGGTTGG + Intergenic
1093709120 12:22309352-22309374 GGCCAAAACCACTCTGTAGTCGG - Intronic
1095749535 12:45695984-45696006 GGCCAGAACCACTCCATGGTTGG + Intergenic
1095905990 12:47378474-47378496 GGCCAGAGCCTTCCTGGGGTTGG + Intergenic
1098114063 12:67155876-67155898 AGCCAGAACCAGTCCATGGTCGG + Intergenic
1098150415 12:67540772-67540794 TCCCAGGACCATTCTCTGGTTGG + Intergenic
1098809531 12:75068797-75068819 GCCCAGAACCAAACTGTGATAGG + Intronic
1099702747 12:86108586-86108608 GGCCAGAACCAATCCATGGTGGG - Intronic
1099865860 12:88279852-88279874 GGCTAGAACCAGTCCGTGGTCGG - Intergenic
1100727415 12:97423272-97423294 GGCCAGAACCACTCCATGATTGG - Intergenic
1103937248 12:124483215-124483237 GGTCAGGACCGTCCTGTGGTCGG - Intronic
1104297881 12:127534709-127534731 GACCAGTACCAGTCTGTGTTAGG + Intergenic
1106394528 13:29367320-29367342 GGGCAGGACCACTCTGTGGAAGG + Intronic
1108921113 13:55675497-55675519 GGCCAGATGCACTCTGTGGTTGG + Intergenic
1109604461 13:64674489-64674511 GGCCAGAACCACTTCCTGGTTGG + Intergenic
1110197642 13:72808795-72808817 GGCCAGTCCCATTCTGTGCCAGG - Intronic
1111179941 13:84651303-84651325 GGCCAGGAGCAGTCCGTGGTTGG - Intergenic
1111208130 13:85039486-85039508 AGCCAGGACCAGTCCGTGGTTGG + Intergenic
1112221952 13:97500193-97500215 GGCCAGCACCAGTCTGTGGTGGG + Intergenic
1112766576 13:102752102-102752124 GGGCAGAACCACTCTGTGGTTGG - Intronic
1112960053 13:105112860-105112882 GGCCAGAACCACTGCATGGTTGG - Intergenic
1115334461 14:32231090-32231112 AGCCAGGCCCATTCTCTGGTTGG + Intergenic
1116687057 14:48053061-48053083 GGCCAGAAGCAGTCCGTGGTTGG + Intergenic
1117751115 14:58924484-58924506 GGCCAGAACCCTCCTGTATTAGG - Intergenic
1119694191 14:76699576-76699598 GGCCAGAACCAGTCCATGGTTGG - Intergenic
1120286723 14:82511688-82511710 AGCCAGAACCACTCTGTGTGTGG - Intergenic
1120538199 14:85722822-85722844 GGCCAGAACCACTTTGTGGTGGG + Intergenic
1120732205 14:88016426-88016448 AGCCAGAACCAGTCCATGGTTGG - Intergenic
1121016109 14:90550221-90550243 AGTCAGAACCAGCCTGTGGTTGG - Intronic
1121960709 14:98256808-98256830 GACCAGAACCAGTCCATGGTGGG - Intergenic
1122089386 14:99328231-99328253 GCCCAGAACCCTCCTGTGCTGGG + Intergenic
1122125505 14:99576476-99576498 GGACAGCACCATCCTGTGCTGGG - Intronic
1122647345 14:103203899-103203921 GGCCACAAGCACTCTGAGGTTGG - Intergenic
1122657173 14:103269846-103269868 GGCCAGAACCACTCTGAGGTCGG - Intergenic
1122961463 14:105095701-105095723 AGCCATCAGCATTCTGTGGTGGG + Intergenic
1124100628 15:26689680-26689702 AACCAGAACCACTCTGTGCTGGG + Intronic
1124157235 15:27236657-27236679 GGTCAGAGCCACTCTGTGGCTGG - Intronic
1124392555 15:29272888-29272910 GGCCAGAACTACTCCATGGTTGG + Intronic
1125129179 15:36261090-36261112 GGCCTGAGCCAATCTGTGGATGG + Intergenic
1126810476 15:52398046-52398068 TGGCAAAAACATTCTGTGGTGGG + Intronic
1131409985 15:92199600-92199622 GACCAGAACCTCTCAGTGGTTGG + Intergenic
1132344115 15:101097420-101097442 GACCAGGACCAGTCTGTGGCCGG + Intergenic
1133768375 16:8853426-8853448 GGCCAGGACCTAACTGTGGTGGG + Exonic
1135296231 16:21281668-21281690 AGCCAGAACCATCCTATAGTCGG - Intronic
1135680837 16:24455387-24455409 GGCCAGAACCAGTCCGTGGTCGG + Intergenic
1136778233 16:32882716-32882738 GGCCAGCACCATGATGTAGTAGG + Intergenic
1136892387 16:33978798-33978820 GGCCAGCACCATGATGTAGTAGG - Intergenic
1139280888 16:65769473-65769495 GGCCAGAACCACTCTGTTGGTGG - Intergenic
1139280921 16:65769810-65769832 GGCCAGAACCACTCTGTTGTTGG + Intergenic
1139471566 16:67180599-67180621 GTCCAGCACCATTCTGTCCTGGG + Exonic
1140234921 16:73150183-73150205 AACCTGAACCAGTCTGTGGTGGG - Intergenic
1140535687 16:75707358-75707380 GGCCAGAATCATTCCATGGTTGG + Intronic
1141930401 16:87198408-87198430 GGGCAGAAGCATCCTGTGGCTGG + Intronic
1141938774 16:87260353-87260375 GGCAAGAACCACTCCGTGGTCGG - Intronic
1142223763 16:88867564-88867586 GGCCAGAATTATTCTGCTGTGGG + Intergenic
1203080655 16_KI270728v1_random:1144825-1144847 GGCCAGCACCATGATGTAGTAGG + Intergenic
1142782091 17:2189291-2189313 GGGCAGAATTATTCTTTGGTGGG + Intronic
1142876887 17:2856616-2856638 GGGCAGAACTAGTCTGTGGGTGG + Intronic
1143655538 17:8291436-8291458 GGCCAGAAACATGGTCTGGTGGG - Exonic
1143995451 17:11002802-11002824 GGCCAGAACCCGTCCATGGTTGG - Intergenic
1148021775 17:44558142-44558164 GGCCAGAACCACTCCGAGGACGG + Exonic
1149017107 17:51920726-51920748 GTGCAGAAGCATTCTGTTGTGGG - Intronic
1149740258 17:59039002-59039024 GGCCAGAACCAGTCCATGGTTGG - Intronic
1151839172 17:76605249-76605271 GGACAGGACAATTCTGTGTTGGG - Intergenic
1151852319 17:76698252-76698274 GGCCCGGCCCATTCTGGGGTTGG - Intronic
1152732794 17:81981080-81981102 TGCCAGAACCACTCCATGGTTGG + Intronic
1153764594 18:8363345-8363367 GGCCAGAACGGTTCTGTGACTGG + Intronic
1154027797 18:10724607-10724629 GTCCAGCACCATTCTGTCTTGGG - Intronic
1155343594 18:24837308-24837330 GGCAAGTACTATTCTGTGGGAGG + Intergenic
1155696291 18:28690832-28690854 GTCCAGAATCACTCCGTGGTTGG + Intergenic
1155844172 18:30684769-30684791 GGCCATAACCAGTCCGTGTTTGG - Intergenic
1155940261 18:31795561-31795583 GGCCAGAACCAATCTGTGGTAGG + Intergenic
1156163111 18:34384182-34384204 GGCTAGAACCAGTCCATGGTTGG - Intergenic
1156406321 18:36786131-36786153 GACCAGAACCAGTCCATGGTTGG + Intronic
1156810516 18:41244036-41244058 GGCAAGAAAGTTTCTGTGGTGGG - Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160126431 18:76176861-76176883 GGACAGAACCTTTCTGGGATTGG + Intergenic
1160653858 19:250154-250176 GGCCAGAACCTCTCTGTTGTGGG - Intergenic
1160859464 19:1231518-1231540 GGCCACAGGCGTTCTGTGGTGGG - Intronic
1161758601 19:6153430-6153452 CCCCAGAATCATGCTGTGGTTGG + Intronic
1165133655 19:33649734-33649756 GGCCAGAACCAGGCCATGGTGGG + Intronic
1165426459 19:35748553-35748575 GGCCACCACCCTTCTGTGGGCGG - Exonic
1168311779 19:55464396-55464418 GTGCAGAAACCTTCTGTGGTTGG + Intergenic
1168531314 19:57132017-57132039 GCCCAAAACCATTCTGAGATCGG + Intergenic
925495826 2:4448074-4448096 GGCCAGAACCAGTCGATGGTGGG - Intergenic
928160028 2:28914430-28914452 GGACTGAACATTTCTGTGGTTGG + Intronic
928536797 2:32249003-32249025 AGCCAGAACCAGTCTGTGGTTGG - Intronic
931263698 2:60641749-60641771 GCACACAACCATTCTGTGGAAGG - Intergenic
932181104 2:69646918-69646940 AGCCAGAACCAGTCTGTGGTTGG - Intronic
932399700 2:71471481-71471503 GGGCTGAATCACTCTGTGGTTGG - Intronic
932609255 2:73186769-73186791 GGACATAAACATTGTGTGGTAGG - Intergenic
935665377 2:105507673-105507695 GGCCAGAACCAGTCCATGGTGGG + Intergenic
935948182 2:108304810-108304832 GCCCAGTCCCAGTCTGTGGTAGG - Intronic
941109975 2:161409615-161409637 GGCCAGGACCATTCTTGGATGGG + Intronic
941438307 2:165500167-165500189 GGTGAGACCCAGTCTGTGGTGGG + Intronic
941690731 2:168498700-168498722 GGCCAGAACCACGCCGTGGCTGG + Intronic
941987196 2:171521506-171521528 GGCCAGAACCGGTCCATGGTCGG + Intergenic
942643219 2:178082794-178082816 GGCCAGAACCACTCCATGGTCGG + Intronic
944366267 2:198923344-198923366 GGCCAGAACCATTCTAAGGGTGG + Intergenic
944417722 2:199495628-199495650 AGCCAGAACCAGTCTATGGTTGG - Intergenic
946119498 2:217497302-217497324 TGCCAGAACCACTCCATGGTTGG + Intronic
948061733 2:235047412-235047434 GGCCAGAAACACTGCGTGGTCGG + Intronic
1172867680 20:38112638-38112660 GGGCAGGAGCATTCTGTTGTGGG + Intronic
1174925084 20:54750497-54750519 GGCCAGAACCACTCTGTGACTGG - Intergenic
1175977553 20:62718718-62718740 AGTCAGATCCATTCTGTGGATGG + Intronic
1176284835 21:5013877-5013899 GGCCGGAGCCAGTCTGTGGTCGG + Intergenic
1176892446 21:14334225-14334247 ATCCAGAAACATTCTGTGGGAGG - Intergenic
1177267504 21:18803799-18803821 GGCCAGAACCACTCTGTGGTTGG + Intergenic
1178213675 21:30568808-30568830 GAGCAGAAGCAGTCTGTGGTTGG - Intergenic
1179872346 21:44249598-44249620 GGCCGGAGCCAGTCTGTGGTCGG - Intronic
1182857235 22:33528587-33528609 GGCCAGAACCACTCTGTGTTGGG + Intronic
1184439549 22:44500473-44500495 GGCCAGAACCACTCCAGGGTTGG - Intergenic
1184569367 22:45312024-45312046 GGCCAGGACCATGCTGGGCTAGG + Intronic
949244446 3:1909397-1909419 GGCCAGAAGTATTATGTGGTTGG - Intergenic
949966571 3:9361804-9361826 GGCCAGAACCACTCCCTGGATGG - Intronic
950465026 3:13148629-13148651 GGTCAGAGCCATCCTCTGGTTGG + Intergenic
950685663 3:14617010-14617032 GGCCAGAACCACTCTGTGGTCGG + Intergenic
952234507 3:31464777-31464799 GGCCAGAGCCAGTCTGTGCATGG - Intergenic
953438025 3:42895408-42895430 GGCCAGAACCACTCAATGGTTGG + Intronic
955441816 3:58964240-58964262 GGCCAGAACCAGTCCATAGTGGG - Intronic
957288237 3:78244369-78244391 GGCCAGAATCACTCCATGGTTGG - Intergenic
957571003 3:81947475-81947497 GGTCAGAACCACCCTGTGGTTGG + Intergenic
958625113 3:96613543-96613565 GGACAGAACCACTCCGTGCTTGG - Intergenic
958672912 3:97227861-97227883 GGCCAGAACTACTCCGTGGTTGG + Intronic
958952930 3:100435930-100435952 GGCTAGAACCAGTCCATGGTTGG + Intronic
960613259 3:119573977-119573999 GGCCAGAACCAATCTGTGATTGG + Intergenic
960689439 3:120328951-120328973 GGCCAGAAACTGTCTCTGGTTGG + Exonic
961870066 3:129981010-129981032 GGCCAGAACCACTCTGTGGTTGG + Intergenic
965472855 3:169116565-169116587 GGCAAGAACCATTTTGCGGCAGG - Exonic
966099046 3:176243507-176243529 GGCCAGAACCACTCCATGGGTGG - Intergenic
966809173 3:183828099-183828121 GGCCAGAACCTGGCTGTGGCCGG - Intergenic
969246804 4:5939879-5939901 GGCCAGAACCACTGCATGGTTGG - Intronic
972707677 4:41561068-41561090 GGTCAGAAACATCCTGAGGTGGG - Intronic
972974112 4:44612591-44612613 GTTGAGAACCATTCTGTGGATGG + Intergenic
973733113 4:53842834-53842856 GGCCAGAACCATTCCATGGTCGG + Intronic
975020858 4:69486351-69486373 TGCCAGAAAAATTCTGTGGGAGG + Intronic
975313015 4:72924750-72924772 TGCCAGAACCACACTGTTGTGGG - Intergenic
977405955 4:96598686-96598708 GGCCAGAACCAGCCTGTGCTTGG - Intergenic
978200806 4:106021955-106021977 GGCCAGAACCACTTTGTGGTTGG - Intergenic
978223319 4:106303812-106303834 GGCCAGAACCACTTCATGGTTGG - Intronic
978446994 4:108789274-108789296 GTCCAGAACCAGAGTGTGGTTGG + Intergenic
981257810 4:142683831-142683853 GACCAAAACCATTCTGTGCTTGG + Intronic
981828971 4:148978460-148978482 GGCCAGAAGGCTTCTGTGCTTGG - Intergenic
983411401 4:167403043-167403065 GGCCAGAACCACTCTGTGGTTGG - Intergenic
984192239 4:176619830-176619852 GGCCAGAACCACTCCATGGTCGG + Intergenic
984408839 4:179369929-179369951 AGCCAGAATCATTCCGTGGCTGG - Intergenic
985882184 5:2646533-2646555 GGCCAGAACCACTCTGGGGTCGG - Intergenic
986689663 5:10303878-10303900 GGCCAGAACCATGTCATGGTTGG - Intronic
987270656 5:16305011-16305033 GGCCAGACCCACTTTGTGGTCGG + Intergenic
990694193 5:58396788-58396810 AACCAGAATCGTTCTGTGGTTGG + Intergenic
991144279 5:63282933-63282955 GGTCAGAACCCCTCCGTGGTTGG + Intergenic
992065473 5:73103698-73103720 GGCCAGAACCACTTCATGGTCGG - Intergenic
992128485 5:73667016-73667038 GGTCAGAACCACTCCGTGGTTGG + Intronic
992468362 5:77029686-77029708 GGCCAGAACTTCTCTGTGGTTGG - Intronic
992997457 5:82347241-82347263 GGACAGAAGCACTCTGTGCTGGG + Intronic
995171626 5:109120472-109120494 TGCCAGTACCATTCTGTTTTGGG + Intronic
995475959 5:112548511-112548533 GGCCAGAACCAGTCCAGGGTTGG - Intergenic
996820498 5:127621281-127621303 GGCCAGAACCAGTCTGTGGTTGG + Intergenic
996873364 5:128216074-128216096 GGACAGAGGCATTCTGTGGAGGG + Intergenic
997007511 5:129835820-129835842 GGAGAGGACAATTCTGTGGTTGG - Intergenic
997435134 5:133868343-133868365 GGCCAGTACCATCCTGGGGAAGG + Intergenic
997662288 5:135598855-135598877 CAGCAGAACCAGTCTGTGGTCGG + Intergenic
999830330 5:155312891-155312913 GGCCAGAACCACTCCATGGTTGG + Intergenic
1000367091 5:160501801-160501823 GGCCAGAACCACCCTGTGGTCGG + Intergenic
1001059619 5:168477332-168477354 GGCCAGAACCATTCAGTGGTGGG - Intergenic
1003024614 6:2543046-2543068 CAGCAGAACCACTCTGTGGTTGG - Intergenic
1003192934 6:3890001-3890023 AGCCGGAACCACTCTGTGGTTGG - Intergenic
1004395747 6:15245472-15245494 GGCCATAGCCATTTTGTAGTCGG + Intergenic
1004432123 6:15554856-15554878 GGCCCGAACCATTCCGTGGTCGG + Intronic
1005591005 6:27327272-27327294 GGCCAGAACCAGTCTGTGGTTGG - Intergenic
1006728315 6:36216011-36216033 GGCCAAAACTTTTCTGTGTTAGG + Intronic
1010002607 6:70962844-70962866 GGCCAGTACCAATCTGTTGGGGG - Intergenic
1010362648 6:75012707-75012729 GACCAGAACAATTCACTGGTTGG + Intergenic
1010659231 6:78549565-78549587 GGCCAGAACCAGTCCGTGGTTGG - Intergenic
1012710958 6:102603869-102603891 GGCCAGAACAACTCTGTCATTGG - Intergenic
1015309594 6:131751726-131751748 AGTCAGAACCAGTCCGTGGTCGG - Intergenic
1016416711 6:143841556-143841578 GGCCAGAACCATTCCATAGTGGG + Intronic
1017354228 6:153483142-153483164 GGCCAGAACCACTCTGTGATTGG - Intergenic
1017975117 6:159350322-159350344 GCCCAGAACCACTCCATGGTGGG + Intergenic
1018648711 6:165972765-165972787 GGCCAGAACAATTCTGGCATTGG + Intronic
1019001694 6:168758808-168758830 GGCTGGAACCACTCTATGGTTGG - Intergenic
1019019555 6:168906618-168906640 AGCCAGAACCAGTCCATGGTCGG + Intergenic
1019188016 6:170232340-170232362 GGCCAGAGCAAGTCTGGGGTCGG + Intergenic
1020464942 7:8466820-8466842 GCCCAGCTCCATTTTGTGGTTGG + Intronic
1021030982 7:15735512-15735534 GGCCAGAACCAGTCCATGGCTGG + Intergenic
1021732346 7:23608222-23608244 GGCCAGAACTACTCTGTGGCTGG + Intronic
1022270790 7:28805598-28805620 TGCCTGACCCATTCTGTGGATGG - Intronic
1023224239 7:37952454-37952476 GGAGAGGATCATTCTGTGGTTGG - Intronic
1023748409 7:43345343-43345365 AGCCAGAACCAGTCTATGGTTGG + Intronic
1023974420 7:45017337-45017359 GGCTAGAACCAGTCTGTGGCTGG + Intronic
1026315737 7:69225641-69225663 GGCCAGAACCAGTCCATAGTTGG + Intergenic
1026548268 7:71344130-71344152 GGCGTGAGCCATTCTGTGGGAGG + Intronic
1026934943 7:74249076-74249098 GACCACAAGCATTCTGTGCTTGG - Exonic
1031283316 7:119833274-119833296 GGCCAGAAACATCCCGTGATTGG - Intergenic
1032134406 7:129262505-129262527 GGCCAGAACCACTCCGTGGTTGG + Intronic
1032184260 7:129710218-129710240 TACCAGAACCAGTCTGTGGGAGG + Intronic
1032915476 7:136484349-136484371 GGCCAGAACCAATCCCTGGTTGG + Intergenic
1033264705 7:139874735-139874757 TGCTAGATCCATTGTGTGGTGGG - Intronic
1033576160 7:142686836-142686858 GGCCAGAAACACTGTTTGGTTGG - Intergenic
1034658943 7:152752608-152752630 GGCCAAAACCACTCTGTGGTTGG + Intergenic
1035269202 7:157710058-157710080 GGCGAGCACCCTTCTGTGGGTGG - Intronic
1035513390 8:209944-209966 GGCCAGAACCTCTCTGTTGTGGG - Intergenic
1038113155 8:24523197-24523219 GGCCAGAGCCACTCCATGGTTGG + Intronic
1038784408 8:30598000-30598022 TACCAGAACTATTCTTTGGTAGG - Intronic
1039071018 8:33649425-33649447 GGCCAGAACCAGTTCATGGTCGG + Intergenic
1044070201 8:87751043-87751065 GGCCAGAACCACTCTGTGGCAGG - Intergenic
1047381205 8:124365491-124365513 GGTCATAACAAGTCTGTGGTAGG + Intronic
1048304715 8:133275878-133275900 TGCCAGACACATTCTGTGCTCGG + Intronic
1049615439 8:143573861-143573883 GGGCAGCACCACTGTGTGGTTGG - Intergenic
1050002507 9:1093185-1093207 GGCCAGAATCTGTCTGTGGTTGG + Intergenic
1050918582 9:11168680-11168702 GGCCAGAACCACTTAGTGGTTGG - Intergenic
1051708096 9:19901749-19901771 GGCCAGAACTAGTCTGTGGTTGG + Intergenic
1052751674 9:32498148-32498170 GGCCAGACCCACTCTGTGGTTGG - Intronic
1053612083 9:39724319-39724341 AGCCAGAGCCATGCTGTGGTGGG - Intergenic
1053870117 9:42482311-42482333 AGCCAGAGCCATGCTGTGGTGGG - Intergenic
1054086174 9:60746837-60746859 GGCCAGAGCCATGCTGTGGTGGG + Intergenic
1054241435 9:62618074-62618096 AGCCAGAGCCATGCTGTGGTGGG + Intergenic
1054555563 9:66652597-66652619 AGCCAGAGCCATGCTGTGGTGGG + Intergenic
1054771212 9:69086076-69086098 GGCCAGAACCACTCCATTGTGGG + Intronic
1055329701 9:75171112-75171134 GGTCAGAACTACTCTGTGGTTGG - Intergenic
1056981355 9:91314864-91314886 GGCCAGAACCACCCTGTGGTTGG - Intronic
1057000072 9:91500516-91500538 GACCAGAGCCAGTCTATGGTTGG + Intergenic
1057318921 9:93994137-93994159 GGTCAGAACCAGGCTCTGGTTGG + Intergenic
1057721963 9:97539285-97539307 TCCCACAACCATTCTGTTGTTGG - Intronic
1058189162 9:101891891-101891913 GGCCAGAGCCAGTCCGTAGTCGG - Intergenic
1059800656 9:117746463-117746485 GACCAGTACCAGTTTGTGGTGGG + Intergenic
1059898117 9:118891311-118891333 GACCAGAACCAGTCCATGGTCGG - Intergenic
1060340942 9:122776597-122776619 GGCCAGAACCAGTCCATGGTTGG + Intergenic
1061010579 9:127952174-127952196 GGCTAGAACCAGGCTGTGGAGGG - Intronic
1185977844 X:4741229-4741251 GGCAACCACCATTCTGTGGCAGG - Intergenic
1186689428 X:11959546-11959568 GGCCAGAACCATTCCATAATGGG + Intergenic
1187153772 X:16705379-16705401 GGCCAGAGCCAGTCCATGGTTGG - Intronic
1191217771 X:57951389-57951411 GGCCAGAAGCCTTGTTTGGTGGG - Intergenic
1191852449 X:65595491-65595513 GGCCAGAATCAGGCTGAGGTAGG - Intronic
1195240553 X:102947510-102947532 GGCCAGAACCGGTCCATGGTTGG + Intergenic
1195614391 X:106901177-106901199 GGCTAGAAGCTTTCTGGGGTAGG - Intronic
1196534381 X:116824893-116824915 GGCAAGAACCACTCCATGGTTGG + Intergenic
1196911881 X:120492220-120492242 GGCCAGAACCAGTCCATGGTGGG - Intergenic
1200101602 X:153691346-153691368 GGCCAGCACCATGATGTAGTAGG - Exonic
1202024642 Y:20507957-20507979 GAGCAGGTCCATTCTGTGGTAGG - Intergenic