ID: 916901024

View in Genome Browser
Species Human (GRCh38)
Location 1:169224041-169224063
Sequence TAGATGATGACAGATATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916901024_916901030 12 Left 916901024 1:169224041-169224063 CCTCCCATATCTGTCATCATCTA 0: 1
1: 0
2: 1
3: 10
4: 193
Right 916901030 1:169224076-169224098 ATGCTCTTCTCATCTCACACAGG 0: 1
1: 0
2: 3
3: 24
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916901024 Original CRISPR TAGATGATGACAGATATGGG AGG (reversed) Intronic
900467854 1:2834524-2834546 TATGTGATGAAAGCTATGGGTGG + Intergenic
906234161 1:44193878-44193900 CAGATGAAGACAGGTATGGGTGG - Intergenic
906659443 1:47572157-47572179 TAGATGATGACATAGATGGGTGG - Intergenic
907646755 1:56252070-56252092 CAGATGAGGCCAGAGATGGGAGG + Intergenic
911261720 1:95694331-95694353 TTGATGAAGACAGCTATGAGGGG + Intergenic
915667570 1:157458854-157458876 TGGATGATGACAGAGGTGGCTGG + Intergenic
916901024 1:169224041-169224063 TAGATGATGACAGATATGGGAGG - Intronic
917577888 1:176343523-176343545 TATATGATGATATAAATGGGTGG - Intergenic
918400829 1:184161335-184161357 GAGATGATTAAAGCTATGGGAGG + Intergenic
919197547 1:194308073-194308095 TAGAGGATGTCAGAAAAGGGAGG - Intergenic
921044292 1:211462668-211462690 TATATGGTGAGAGATAGGGGGGG - Intergenic
921588884 1:216980497-216980519 TAGATGGGGATAGATATGGCTGG - Intronic
923984396 1:239364689-239364711 TAGATGAGTACAGATATAGGAGG + Intergenic
924125989 1:240852199-240852221 TAGCTGCTGACTGATCTGGGCGG - Intronic
924234167 1:241986825-241986847 TAGATGTTGCCAGATGTTGGAGG - Intergenic
924824742 1:247527358-247527380 AAGAAGATGACAGATATTTGGGG + Intronic
1063943834 10:11158063-11158085 AAGATGAAGACAAATATAGGGGG - Intronic
1066398322 10:35048944-35048966 TTGATGAGCACAGATATAGGTGG + Intronic
1066712401 10:38250124-38250146 TATATGATTATATATATGGGGGG + Intergenic
1067823028 10:49547575-49547597 TGGCTAATGACAGTTATGGGGGG - Intergenic
1072040662 10:91603087-91603109 AAGATGTTAATAGATATGGGTGG + Intergenic
1072327378 10:94311732-94311754 TAGATGAGGACAGACAGAGGTGG - Intronic
1073696174 10:105871010-105871032 TAGCTGCTGACTGATCTGGGTGG + Intergenic
1077437905 11:2552274-2552296 TATATGGTGACAGGTATGGATGG + Intronic
1077458406 11:2694819-2694841 AAGGGGATGACAGATATGGCAGG + Intronic
1081509853 11:43759212-43759234 TATATGATGACAGATTTCGAAGG - Intronic
1081909001 11:46688241-46688263 TAGGAGATGACAAGTATGGGCGG - Exonic
1084847904 11:71915096-71915118 TAGCTGCTGACAGATCAGGGTGG - Intronic
1085706825 11:78794098-78794120 TAGGTGATTACACATTTGGGTGG - Intronic
1085821393 11:79797446-79797468 TAGATGATGACCGCTATTTGGGG - Intergenic
1087008745 11:93493902-93493924 TAGAGAATGACAGAGAGGGGTGG - Intronic
1088181022 11:107110982-107111004 TCCATTATGACAGATATGTGTGG - Intergenic
1088305025 11:108398695-108398717 TAGGTGATGGCACATATGGTAGG + Intronic
1089978251 11:122751389-122751411 CAGATGACGACAGAGATGGGAGG - Intronic
1093215039 12:16351917-16351939 AAGAAGATGACAGATATAAGGGG + Intronic
1093900987 12:24632024-24632046 TAGAAGAGAACAGATATGCGGGG - Intergenic
1095490711 12:42731057-42731079 GAGAAGATGACAGATTTGAGGGG - Intergenic
1096906400 12:54940617-54940639 TAGCTGATGACTGATCAGGGTGG - Intergenic
1097111914 12:56666247-56666269 TAGATGATGAACAACATGGGTGG - Exonic
1104372751 12:128237824-128237846 GAGATGCTGACAGATACAGGGGG + Intergenic
1104659738 12:130602295-130602317 TAGGTGTTGAGAGAGATGGGCGG - Intronic
1106336810 13:28790938-28790960 TAGCTAATGGCAGTTATGGGGGG - Intergenic
1106931026 13:34665435-34665457 TATGTGATGACAGATATGTAAGG + Intergenic
1107212537 13:37874608-37874630 CTGATGGTGACAGATATTGGTGG + Intergenic
1107947503 13:45432475-45432497 TAGAAGATGAAAGAGATGTGTGG - Intergenic
1108441248 13:50455061-50455083 TTGATGCTGACAGATATTGCAGG - Intronic
1109981998 13:69921409-69921431 TAAATGTTGTCAGATATGGAAGG + Intronic
1111320177 13:86616727-86616749 TTCAAGATGACAGATTTGGGTGG + Intergenic
1112498212 13:99922255-99922277 TGGAAAATGACAGATATGGCGGG + Intergenic
1112542899 13:100334758-100334780 AAAATGATGAGAGATATGGAGGG + Intronic
1112838790 13:103549813-103549835 AAGATGAAGACAGAAATTGGAGG - Intergenic
1113345513 13:109474076-109474098 TATATGAAGACAGAGATGTGGGG + Intergenic
1113847472 13:113401029-113401051 AACATGATGACAGACACGGGAGG - Intergenic
1115862860 14:37708946-37708968 GAGATGATGGCACATTTGGGTGG - Intronic
1117399881 14:55349263-55349285 TAGATAATCACTGATATGGCAGG + Intronic
1117744286 14:58852234-58852256 TAGATTAATACAGATATGGTGGG + Intergenic
1119664080 14:76472042-76472064 TAGTTAATGACAGAGCTGGGTGG + Intronic
1119901956 14:78268547-78268569 CAGAGGATGATAGATTTGGGTGG + Intronic
1120933994 14:89875485-89875507 AAAATGGAGACAGATATGGGTGG + Intronic
1121348642 14:93155111-93155133 TAGTTGATGAAAGAAATTGGGGG - Intergenic
1124116382 15:26847136-26847158 TAGCTCATCACAGACATGGGAGG + Intronic
1127047859 15:55046283-55046305 TTGGTGATGACAGAGATGGCTGG - Intergenic
1127763403 15:62163743-62163765 TAGACGATGACAAATGTGGATGG + Exonic
1129926445 15:79368559-79368581 TAGATGATGCCAGGAATTGGGGG + Intronic
1130117734 15:81020024-81020046 TAAATGATCAGAAATATGGGGGG - Intronic
1131660885 15:94514665-94514687 TAAAAAATAACAGATATGGGGGG + Intergenic
1133740392 16:8646925-8646947 TAGAGGATGACAGGAAGGGGTGG - Exonic
1134230054 16:12421958-12421980 TAGATGATGCCTGTGATGGGTGG - Intronic
1136991717 16:35155837-35155859 TAGAAGATGACTGAGGTGGGGGG - Intergenic
1140916296 16:79496581-79496603 TAGATGAAGGCAGATATCTGAGG - Intergenic
1141211408 16:81983868-81983890 TATATGGTGAAAGATAGGGGGGG - Intergenic
1142676161 17:1514662-1514684 TAGATGATGACAGAGGGGTGTGG - Intronic
1148348415 17:46920327-46920349 CAGACCATGAGAGATATGGGAGG + Intergenic
1150174669 17:63039072-63039094 TTGTTGATGAAAGGTATGGGAGG + Intronic
1154268638 18:12900297-12900319 CAGATCATGGCAGATAAGGGTGG + Intronic
1155172923 18:23280462-23280484 CAGAAGATTACAGATATGGCTGG - Intronic
1155293186 18:24361605-24361627 TAGGTGATTACAGAGATGGGAGG + Intronic
1155920968 18:31602413-31602435 TATAAGATGGCAGATGTGGGTGG + Intergenic
1156043766 18:32855108-32855130 TAGATGAGGAAATAGATGGGAGG + Intergenic
1158629008 18:59095936-59095958 AAGATGAAGGCAGAGATGGGGGG + Intergenic
1158778005 18:60610669-60610691 TATTTGATAACAGATAAGGGAGG + Intergenic
1158860680 18:61589341-61589363 TAGCTGATGACAGATACCAGAGG + Intergenic
1162032497 19:7923554-7923576 TAGAGGAAGATAGATAGGGGTGG + Intergenic
1162653046 19:12105925-12105947 CAGATGTTGTCATATATGGGTGG + Intronic
1167427637 19:49437563-49437585 AAGAGGGTGACAGAGATGGGGGG + Intronic
928281518 2:29950463-29950485 CAGATGAAGACAGATGTAGGAGG - Intergenic
928774084 2:34737679-34737701 TAAGTGATGAGGGATATGGGGGG + Intergenic
930816490 2:55603292-55603314 TAGGTGTTGACATATAGGGGTGG + Intronic
931137245 2:59416749-59416771 TGGATGAGGAGAGATGTGGGAGG + Intergenic
931462452 2:62460972-62460994 GAGATGAGGACAGATTTTGGAGG + Intergenic
933344229 2:81063417-81063439 TATATGATGTTAGAGATGGGTGG - Intergenic
936810318 2:116391700-116391722 TAGAAGATGGCAGAGGTGGGAGG - Intergenic
939600723 2:144186839-144186861 TAGGTGATGACATTTCTGGGTGG - Intronic
940518732 2:154715399-154715421 GACATGATCACAAATATGGGAGG - Intronic
947079725 2:226382674-226382696 TATATCATGAGAGATAAGGGAGG + Intergenic
947411566 2:229846328-229846350 TAGATGTTGACTGATCAGGGTGG - Intronic
1170527288 20:17251841-17251863 TAGAGGATGACTGGTATGGCTGG + Intronic
1173555892 20:43965382-43965404 GAGAAGATGACAGCTATGGAGGG - Intronic
1173842558 20:46167563-46167585 TAGAGGATGAAAGAAATGAGAGG - Intergenic
1177214479 21:18110535-18110557 TAGGTGTTGGCAGGTATGGGTGG - Intronic
1177515374 21:22143998-22144020 AAGATAATGAGAGATGTGGGAGG - Intergenic
1177861955 21:26464687-26464709 TAGAAGATGACAGAGATGAGAGG + Intergenic
1185108469 22:48887442-48887464 TAGATGAGTACATATGTGGGTGG - Intergenic
1185108506 22:48887604-48887626 TAGATGAGTACATATGTGGGCGG - Intergenic
949463582 3:4320560-4320582 GAGGTGATGACAGTTATGAGAGG + Intronic
951534999 3:23732600-23732622 TAGAATATGACAGATGTGTGGGG + Intergenic
951657201 3:25022865-25022887 GAGATGAGGACAGATATGTCAGG + Intergenic
953358062 3:42271154-42271176 TAGATGAAGTCAGATGGGGGAGG - Intergenic
954363053 3:50132642-50132664 CAGATGGTGCCAGATAGGGGTGG + Intergenic
954848494 3:53580202-53580224 TACATGATGTCCTATATGGGAGG + Intronic
960024542 3:112993408-112993430 TAGATGATCACTGTTATAGGAGG - Intronic
961040781 3:123676540-123676562 TAGAGGCAGACACATATGGGAGG + Intronic
961341673 3:126227280-126227302 TACTTGATGCCAGAGATGGGAGG + Intergenic
962005801 3:131348443-131348465 AAGATGATAAAAGATAGGGGAGG + Intronic
962964853 3:140344176-140344198 CAGATGATGACACACATGGGAGG - Intronic
968064546 3:195751278-195751300 TAGAGGATGGCAGATGGGGGTGG + Intronic
968801799 4:2747718-2747740 CAGATGCTGACACATGTGGGCGG + Exonic
970043473 4:11822924-11822946 TAGTTGATGTCAGAGAGGGGAGG + Intergenic
970098298 4:12490067-12490089 TAGATGAGAGGAGATATGGGTGG - Intergenic
970397791 4:15687702-15687724 TAGTTTATGTCAGATATGCGTGG + Exonic
972837502 4:42890973-42890995 TAGCTGCTGACAGATCAGGGTGG - Intergenic
973068098 4:45822337-45822359 TAGATGTTGACAGGGATGTGGGG + Intergenic
975098042 4:70480348-70480370 TTGATGATGGTAGATATGAGGGG + Intronic
976351151 4:84061252-84061274 TGGAGGATGACAGATATGGCAGG + Intergenic
977592067 4:98838009-98838031 TAAATAATGACAGAAATGGTTGG + Intergenic
977976483 4:103272550-103272572 TGGATGATGACAGATGTGGCTGG + Intergenic
979474458 4:121138837-121138859 GAGATGATGGCAGTGATGGGGGG - Intronic
980410249 4:132408308-132408330 TAAATGCTGCCATATATGGGAGG + Intergenic
983290126 4:165791753-165791775 TAGCTGTTGACTGATAAGGGTGG + Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985795920 5:1962052-1962074 TGGATGGAGACAAATATGGGGGG - Intergenic
987210831 5:15681096-15681118 TAGAACATGACAGATCTGGTAGG + Intronic
988250426 5:28750393-28750415 TAGATGATACCAGATGTGAGTGG - Intergenic
988259031 5:28859188-28859210 TAGATCAACACAGATGTGGGGGG - Intergenic
990070780 5:51780542-51780564 TAGATAATGGCAGTTATGGAGGG - Intergenic
991032921 5:62101248-62101270 AAGATAATGACAGATTTGAGAGG + Intergenic
992204806 5:74421108-74421130 TAGATGAAGAAAGGGATGGGAGG + Intergenic
997506915 5:134424954-134424976 TAGATAATGAGATACATGGGAGG - Intergenic
999132280 5:149293314-149293336 TAGAAAATGACAGAGCTGGGAGG + Intronic
999820986 5:155228511-155228533 TGGATGCTATCAGATATGGGTGG - Intergenic
1000165927 5:158648685-158648707 AAGATGAAGACAGATAGAGGTGG + Intergenic
1000282525 5:159794357-159794379 AAGATGAAGACAGACATTGGGGG + Intergenic
1002027083 5:176402943-176402965 CAGATGCTGCCAGATGTGGGAGG + Intronic
1002872995 6:1184444-1184466 AAGAGTGTGACAGATATGGGAGG - Intergenic
1002883584 6:1274194-1274216 GAGGAGGTGACAGATATGGGAGG - Intergenic
1003652188 6:7971178-7971200 AAGATGATGACAGACTTTGGGGG + Intronic
1010359702 6:74978269-74978291 TATAAGATGAGAGATATAGGCGG - Intergenic
1013112433 6:107074781-107074803 TAGATGATAACTGATTTTGGTGG + Intronic
1013469552 6:110449728-110449750 AAGATGAAGACATATTTGGGAGG - Intronic
1014416044 6:121185859-121185881 CAGATGATCATAGATATTGGTGG + Intronic
1015478434 6:133679672-133679694 GAGATGAAGACAGAGATGGAAGG + Intergenic
1015982410 6:138852503-138852525 AAGATGATCCCAGATATGGCTGG + Intronic
1017945073 6:159089919-159089941 TAGATGATGGCAGAAATGATGGG + Intergenic
1019016224 6:168881886-168881908 CACAAGATGACAGAGATGGGTGG + Intergenic
1019129022 6:169860070-169860092 CAGATGATGACAGCGATGGTGGG - Intergenic
1020137633 7:5595592-5595614 TAGAAGGTGGCAGGTATGGGGGG + Intronic
1023396737 7:39758510-39758532 TAGAGGCTGAGAGAGATGGGAGG + Intergenic
1024292880 7:47818167-47818189 CAGATGGAGACAGAGATGGGAGG + Exonic
1024736738 7:52313123-52313145 ACCATGATGACAGATATGGAAGG - Intergenic
1026736736 7:72953787-72953809 TAGATGGTTACAGATAAAGGTGG + Intergenic
1027106998 7:75411276-75411298 TAGATGGTTACAGATAAAGGTGG - Intergenic
1028366203 7:90035724-90035746 GAGATAATGACAGAGATGGTGGG + Intergenic
1029024522 7:97401928-97401950 TAGAAACTGACAGAGATGGGAGG - Intergenic
1030974323 7:116102386-116102408 TAGATGATGACTGATCTCTGAGG + Intronic
1031735771 7:125359188-125359210 TTGCTGCTGACAGATCTGGGTGG + Intergenic
1033658111 7:143386834-143386856 TGGATGATGACTGAGATGGACGG + Intronic
1033898151 7:146101212-146101234 AAGAAGATTACAAATATGGGTGG - Intergenic
1034250235 7:149684506-149684528 TGGATAATGGCAGTTATGGGGGG - Intergenic
1038609930 8:29051142-29051164 TGGATGATGACTGATCAGGGAGG + Exonic
1039758996 8:40553703-40553725 TAGATAATGAATGATATGGATGG + Intronic
1039947861 8:42145484-42145506 TAGAGGAAGACAAAGATGGGGGG + Intergenic
1040716156 8:50255381-50255403 TGCATGATGACAGACATGGTTGG - Intronic
1041139740 8:54804127-54804149 TAAATGATTACATATGTGGGGGG + Intergenic
1043442676 8:80290177-80290199 TAAATGCTGGCAGATATAGGTGG + Intergenic
1043909123 8:85840033-85840055 TAGAAGACAGCAGATATGGGTGG - Intergenic
1043946506 8:86260173-86260195 CAGCTGAGGACATATATGGGAGG - Intronic
1044522107 8:93210659-93210681 TAGGTGAAGACAGAAAAGGGAGG + Intergenic
1045413876 8:101947379-101947401 TATTTGATGAGAGAAATGGGTGG - Intronic
1045434116 8:102142581-102142603 AATATGATTACAGATATGTGTGG + Intergenic
1045949463 8:107835216-107835238 TAGATCAAGACAGATATGTGTGG + Intergenic
1046664524 8:116986212-116986234 TAGATGAACACATATATGTGTGG - Intronic
1047200174 8:122758623-122758645 TAGATGAGGACAAAGAAGGGGGG + Intergenic
1047211743 8:122846131-122846153 TAGATGTTGGCAGAGAGGGGAGG + Intronic
1053327776 9:37171671-37171693 AAGAAGATGTCAAATATGGGAGG - Intronic
1056256905 9:84808832-84808854 TAAATGATGACACAGATTGGTGG + Intronic
1056726958 9:89127679-89127701 TAGCTAATGGCAGTTATGGGGGG + Intronic
1056903932 9:90628399-90628421 AAGATGATCACAGCTGTGGGTGG - Intronic
1058836085 9:108859588-108859610 TAGCTGGTGACAATTATGGGGGG + Intergenic
1060171996 9:121469430-121469452 TAGACGATGAAAGGCATGGGAGG + Intergenic
1061440874 9:130602625-130602647 GGGATGATGACAGATATTGGAGG + Intronic
1188805041 X:34577871-34577893 TAGAACATGACAGATCTGGCTGG + Intergenic
1189681632 X:43522475-43522497 TAGATGAAGGCAAATCTGGGGGG - Intergenic
1190022031 X:46887563-46887585 CAGAGGATGACAGATCTGAGAGG - Exonic
1192888623 X:75363983-75364005 TAGCTAATGAAAGTTATGGGGGG + Intergenic
1193630274 X:83877069-83877091 AAGATGAAGACAGCTAAGGGAGG - Intronic
1194066008 X:89262857-89262879 TACGTGATGACTGATATGGTGGG - Intergenic
1196637004 X:118013687-118013709 TAAATTATAACAGATATGGAAGG + Intronic
1197028168 X:121781079-121781101 TATATGGTGAGAGATATGAGTGG + Intergenic
1198285816 X:135190657-135190679 TACATGCTGAGAGATAAGGGTGG - Intergenic
1198287309 X:135204073-135204095 TACATGCTGAGAGATAAGGGTGG + Intergenic
1199221138 X:145316748-145316770 AAAATGATGAGGGATATGGGTGG - Intergenic
1199714372 X:150495772-150495794 TAGATGTTCCCAGATCTGGGAGG - Intronic
1200720176 Y:6596981-6597003 TACGTGATGACTGATATGGTGGG - Intergenic
1201696008 Y:16827067-16827089 GAGAAGATGGCAGAAATGGGAGG - Intergenic
1201721824 Y:17106962-17106984 GAGATGATCACAGCTATGGCAGG - Intergenic