ID: 916906941

View in Genome Browser
Species Human (GRCh38)
Location 1:169296248-169296270
Sequence CTTTGTAAGGTGAATGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916906941 Original CRISPR CTTTGTAAGGTGAATGTTGA TGG (reversed) Intronic
904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG + Intergenic
905003798 1:34694458-34694480 CTTTGCAAGGTGGCTGTTAAGGG - Intergenic
905704204 1:40041862-40041884 GTTTTTAAGATGAATTTTGAAGG + Intronic
905881079 1:41464119-41464141 CTTTGAAGAGTGAATATTGATGG - Intergenic
906789237 1:48644281-48644303 CTGTGTGAGATGAATCTTGAAGG - Intronic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907494227 1:54832086-54832108 CTTTGGAAGGCCAATGTTGGTGG - Intronic
907882766 1:58566444-58566466 CTTTGTAAGCTGATTTTTCAGGG - Intergenic
909629527 1:77757109-77757131 CTTTGAAAGGTAAATATTGGAGG - Intronic
910781244 1:90936652-90936674 TTTTTGAAGGTTAATGTTGAAGG - Intronic
911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG + Intergenic
912850299 1:113118274-113118296 CTTTGAAAACTGAATGATGAAGG - Intronic
913657405 1:120974504-120974526 TTTTTTAAAGTGAATGTTTAGGG - Intergenic
914008752 1:143757586-143757608 TTTTTTAAAGTGAATGTTTAGGG - Intergenic
914521965 1:148425779-148425801 TTTTTTAAAGTGAATGTTTAGGG - Intergenic
914647382 1:149666239-149666261 TTTTTTAAAGTGAATGTTTAGGG - Intergenic
916501523 1:165391598-165391620 CTTTGGAAGGTGGATTTTCAAGG + Intergenic
916906941 1:169296248-169296270 CTTTGTAAGGTGAATGTTGATGG - Intronic
917953522 1:180066901-180066923 CTTTGAATGGTAAATGTTGGGGG + Intronic
919348791 1:196421279-196421301 CTTTGTAATGTGAATTTGGAAGG - Intronic
922370463 1:224905663-224905685 CTTTGTAATTTAAATGTTAAAGG - Intronic
1066624448 10:37392021-37392043 GTTTGTAATGTGGATGTGGAAGG + Intergenic
1068599433 10:58940322-58940344 CTTTGTAAGGAGTATATTGTTGG - Intergenic
1069101948 10:64333110-64333132 CTTGGTGAAGTGAATGTTGCTGG + Intergenic
1069239349 10:66119972-66119994 CTTTGTATGGTCAATGGAGAAGG + Intronic
1070645590 10:78199995-78200017 CTTTGGAAGGTAAACCTTGAAGG + Intergenic
1073469345 10:103713173-103713195 CTCTGTAAGTTGGATCTTGAGGG - Intronic
1073537671 10:104292399-104292421 CTTTGGAAGGTCAAAGTGGAAGG - Intronic
1073553681 10:104427479-104427501 CTCTGTGAGATGGATGTTGATGG + Intronic
1074135125 10:110619296-110619318 CTTTGTAAGATCCTTGTTGAGGG - Intergenic
1075113358 10:119605743-119605765 CTTTGGGAGGTCAATGTAGAAGG + Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076849105 10:133084281-133084303 CTTTGGAAGGTCAGTGTTGAAGG + Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077826842 11:5820189-5820211 CAATGTAAGGTGAATGTACATGG + Intronic
1079316159 11:19409556-19409578 CTTTCTAAGTGGAATGGTGAAGG + Intronic
1080810013 11:35694440-35694462 CTTTATAAGGTAAAAGATGAAGG - Intronic
1081440591 11:43076695-43076717 TTTTGGATGGTGAATGTTGAAGG - Intergenic
1082223967 11:49678735-49678757 CTTTTTAATGGGAATGGTGATGG - Intergenic
1084718952 11:70891888-70891910 CTTTGAAATGTTAATGTGGAAGG + Intronic
1086434610 11:86769217-86769239 CTGTTCAAGGTGAATCTTGAAGG - Intergenic
1086625073 11:88940427-88940449 CTTTTTAATGGGAATGGTGATGG + Intronic
1089044005 11:115483408-115483430 CTTAGGAAGGTAAATCTTGAAGG - Intronic
1089799995 11:121019790-121019812 CTTTGGAAGGTCAAGGTGGAAGG + Intergenic
1090162770 11:124512905-124512927 CTTTAAACGGTGAATGATGATGG + Intergenic
1090561548 11:127938138-127938160 CTTTGGAAGGTCAAGGCTGATGG + Intergenic
1094057451 12:26281502-26281524 CTTTGAAAAGGGAATGCTGATGG - Intronic
1095660072 12:44722407-44722429 CTTTGGGAGGTCAAGGTTGAAGG - Intronic
1097058362 12:56264294-56264316 CTTTGGGAGGTGAAGGTTGGTGG - Intergenic
1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG + Intronic
1097739438 12:63222098-63222120 CTTTCTAAAATGAATGTTAATGG + Intergenic
1099281857 12:80660005-80660027 CTTTCTAAGGTGAAGATTGTAGG - Intronic
1099940870 12:89186776-89186798 CTTTTCAAAGTGAATATTGAGGG - Intergenic
1100554537 12:95680009-95680031 CTTTGAAAGGTGACATTTGAGGG - Intronic
1101734256 12:107451330-107451352 ATCTGTATGGAGAATGTTGAAGG + Intronic
1101804835 12:108054647-108054669 CTTTGGGAGGTCAAGGTTGATGG - Intergenic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1104410104 12:128550727-128550749 CTTTGTGAGATGAATTTTGGAGG + Intronic
1106164073 13:27226558-27226580 GTTTGAATGGTGAATGATGACGG + Intergenic
1109139267 13:58693475-58693497 TTATTTAGGGTGAATGTTGAAGG - Intergenic
1109598209 13:64585908-64585930 CTTAATAAGGTGTATTTTGATGG + Intergenic
1110055366 13:70963387-70963409 CATTGTAAGGAGAATCTTCAGGG - Intergenic
1110726041 13:78825045-78825067 TTGTGTAATGTGTATGTTGAAGG + Intergenic
1112279646 13:98051344-98051366 CTTTGGAAGGCGAATGTGGGTGG + Intergenic
1112787339 13:102965449-102965471 TTTAGTAAGGTGTATGGTGAAGG + Intergenic
1113430641 13:110247506-110247528 CTTTATAACGTGAATACTGATGG - Intronic
1118159839 14:63277220-63277242 CTATGAAATGTGAATGTTGATGG + Intronic
1118662715 14:68031928-68031950 CCTTCTAAGGTGAATGTGGATGG - Intronic
1119125260 14:72119456-72119478 ATTTGAAAGGTCAATGATGAAGG + Intronic
1119988963 14:79173284-79173306 CTTTGTAAGGCCAATGTGGGAGG + Intronic
1121748273 14:96320635-96320657 ATTTATAAAGTGAATGTTTAAGG + Intronic
1122589541 14:102837380-102837402 CTTTGGAAGGTCAAGGTGGAAGG - Intronic
1124988176 15:34643764-34643786 ATTTATAAAGTGAATGTTGTAGG + Intergenic
1125438537 15:39674870-39674892 TTTTATAAGGTGACTTTTGATGG - Intronic
1126405299 15:48316907-48316929 CTTTGTAAGGGGGAAGCTGAGGG + Intergenic
1128189897 15:65682277-65682299 CTATGTAAGGTCACTGATGAAGG - Intronic
1130418119 15:83713691-83713713 CTCTGCAAGCTGAATTTTGAAGG + Intronic
1136689465 16:32018586-32018608 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136790054 16:32962128-32962150 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136879759 16:33891808-33891830 CTTTGGAAGGTGGAAGTGGAAGG - Intergenic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1141261150 16:82454844-82454866 CTTTTGAAGGTGAATGTCAAGGG - Intergenic
1141404109 16:83776677-83776699 TTTTGTAAGGAGAATGTTACTGG - Intronic
1142012343 16:87722072-87722094 CTTTGACACGTGAATGTTGCTGG + Intronic
1203092258 16_KI270728v1_random:1223591-1223613 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1142813110 17:2405291-2405313 CTTTGTTAGGTGAGTGGTGGGGG - Intergenic
1146282019 17:31550565-31550587 CTTTGGAAGGTGAATTATGCAGG + Intergenic
1149220695 17:54412864-54412886 CTTTGGAGAGTAAATGTTGAAGG - Intergenic
1152179417 17:78809248-78809270 CTTTGTATGCTTAAAGTTGAAGG - Intronic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1155257087 18:24008172-24008194 GTTTGTAAGTTGAATGGTGAGGG - Intronic
1155760317 18:29557238-29557260 TATTGTAAGGTGAATGGCGAAGG - Intergenic
1156049519 18:32915366-32915388 CTTTGGAAGGTGAAAGTGTAGGG + Intergenic
1156844936 18:41654794-41654816 CTTTGTAAAATGAAGCTTGATGG - Intergenic
1156881641 18:42087353-42087375 GTTTGCAAGGTGCATGTGGAAGG + Exonic
1157181379 18:45501285-45501307 CCTTATAAGGGGAGTGTTGATGG - Intronic
1157728860 18:49986722-49986744 CTTTGAAAGGTGAGTGTAAAGGG - Intronic
1160372734 18:78388385-78388407 CTTTGCAAGGTCTATGTTCAAGG - Intergenic
1162606631 19:11713969-11713991 AATTGTAGAGTGAATGTTGAAGG - Intergenic
1163862612 19:19750116-19750138 CTGTGTAGGGTGGATGTGGAAGG - Intergenic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166983824 19:46648395-46648417 CTTTGGAAGGTAGATGTGGAAGG + Exonic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
925076128 2:1017774-1017796 CTGTGTCAGGTGAATGTTAAAGG + Intronic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
925738586 2:6985552-6985574 CTTAGGAAGGTGGATGTGGAAGG + Intronic
926184370 2:10677250-10677272 CTTTGTAAGGCAAAAGTTGGAGG + Intronic
926834354 2:17001114-17001136 CTTTGTGAGGCCAAAGTTGAGGG + Intergenic
926983650 2:18597972-18597994 CTTACTAAAGTGAGTGTTGAAGG - Intergenic
928828762 2:35453425-35453447 CTTTGTAGTGTGAATTTGGAAGG - Intergenic
936820653 2:116516419-116516441 CCTTGGAAGGTGATTGGTGAAGG + Intergenic
936946899 2:117939289-117939311 CAATGAAAGGAGAATGTTGAAGG + Intronic
937815916 2:126250865-126250887 CTATGGGAGGTAAATGTTGATGG - Intergenic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
939606972 2:144265326-144265348 TTTTGTAATGTGAATGTTAAAGG - Intronic
939999697 2:148954637-148954659 GTTTGTATGTTGAATGTGGAAGG + Intronic
941784903 2:169487174-169487196 CTTTGTCAGGTGAATTTGCATGG + Intronic
943862420 2:192884954-192884976 CTTTGCAAGATGTAGGTTGAGGG - Intergenic
944110760 2:196129383-196129405 CTTTCTAATGTGCATGTTAAAGG - Intergenic
944176620 2:196836750-196836772 CCTAGTAAGGTAAATGTAGAAGG - Exonic
944488160 2:200228411-200228433 CTTTGTAATATGAATTTTGTGGG - Intergenic
945085823 2:206131297-206131319 CTTTTTAACATGTATGTTGATGG - Intronic
945102196 2:206272532-206272554 CTTTGGGAGGTGAATGTGGGAGG + Intergenic
945483952 2:210372300-210372322 CATTGATAGGTGAATTTTGAAGG + Intergenic
946602964 2:221371874-221371896 CTTTCTCAGGTGAGGGTTGAGGG + Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
1169033768 20:2433119-2433141 CTCTGTAATGGGAGTGTTGAGGG - Intergenic
1169950283 20:11035825-11035847 CTTTGTTAAGTGAATGCTCATGG + Intergenic
1172083919 20:32363709-32363731 CTTTCTGAGCTGAATCTTGAAGG + Intronic
1172105172 20:32512755-32512777 CTTTGTAAGTAGAATTTTTATGG + Intronic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1173439089 20:43059369-43059391 CTTTCTAAGCAAAATGTTGAAGG - Intronic
1173972615 20:47164329-47164351 ATTTGTAAGGGGATTGTTGGGGG - Intronic
1174759663 20:53194620-53194642 CTTTGTAAGATGGCAGTTGAGGG + Intronic
1176970078 21:15254985-15255007 GTTTGTAAGGTTAATTTTAATGG - Intergenic
1178803800 21:35821665-35821687 CTTTGGAAGGTGAAGACTGAAGG + Intronic
1179808595 21:43855743-43855765 GTTTATATGGTGAATGCTGATGG + Intergenic
1180063565 21:45401191-45401213 CTATGCAAGGTGGATGATGATGG - Intergenic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
951123387 3:18955806-18955828 CTTTGTCACATGAATTTTGAGGG - Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
953556231 3:43948906-43948928 TGTGGAAAGGTGAATGTTGAGGG + Intergenic
954761880 3:52880661-52880683 CTTTGTAAGGAGGCAGTTGATGG - Intronic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
957601600 3:82342395-82342417 CTTTGGAAGGTCAAAGTAGAAGG + Intergenic
958514991 3:95102768-95102790 ATTTTTAAGGTGCTTGTTGAGGG + Intergenic
958541402 3:95479329-95479351 CTTTGTTAGAAGAATGTTGTAGG - Intergenic
958751181 3:98194450-98194472 CTTTGTAAAATAAATGTTGAAGG - Intronic
959113786 3:102152098-102152120 CTTTGCTAGGGGAGTGTTGAAGG - Intronic
959360123 3:105378434-105378456 CTTTCTAAGAAGAATGTTTATGG + Intronic
959364633 3:105441657-105441679 CATTGGAAGGTGAATTATGAAGG - Intronic
959712619 3:109400089-109400111 CTTTGTTAAGTGAATTTTAATGG + Intergenic
962066790 3:131989969-131989991 ATTTGGAAGGGGAATGTTGCTGG + Intronic
964058859 3:152495982-152496004 CTTTGTAAGGTGAGTATTTTGGG - Intergenic
964741196 3:159968107-159968129 CTTTGTAAGCTTAATTTTAATGG + Intergenic
965959573 3:174412820-174412842 CCTTTTAAGGTGCATGTTGATGG - Intergenic
966259687 3:177960990-177961012 CTTTATGAGCTGAATGATGAGGG - Intergenic
966480377 3:180401582-180401604 GATTTTAAGGTGAAAGTTGAAGG - Intergenic
967339999 3:188386416-188386438 CAATGTAATGTGAATTTTGAGGG - Intronic
968026681 3:195448524-195448546 CTTTGTAATGTCTATATTGATGG - Intergenic
970980339 4:22089044-22089066 GCTTGAAAGGTGAATGGTGAAGG + Intergenic
973149500 4:46869578-46869600 TTTAGAAAAGTGAATGTTGAGGG - Intronic
973184077 4:47303341-47303363 ATGTTTAAGGTGAATGTTGAAGG + Intronic
975480577 4:74875428-74875450 CTGTCTAAGGTCAATGTGGAGGG - Intergenic
975691456 4:76968259-76968281 CTTTATAAGGTGACCTTTGAAGG - Intronic
979016233 4:115437245-115437267 CTTTGTATGGTAGATATTGATGG + Intergenic
979463431 4:121008773-121008795 ATTTATAAGGTGAAAGCTGATGG + Intergenic
980293901 4:130884081-130884103 CTCTATAAGGTGAAAATTGATGG - Intergenic
981703439 4:147633351-147633373 CTTTGTAAGGCCAACGTTGGGGG + Intronic
981974908 4:150714849-150714871 GCTTGTTAGGTGAATGTGGATGG - Intronic
982141566 4:152325621-152325643 CTTTGATAGCTGAAAGTTGATGG - Intronic
983515593 4:168653206-168653228 CTATGTTAGGTCTATGTTGAAGG - Intronic
983929410 4:173436563-173436585 CAGTGTTTGGTGAATGTTGATGG - Intergenic
984289262 4:177772849-177772871 GTTTGTGAGATAAATGTTGAAGG + Intronic
986831363 5:11582583-11582605 TTTTGAAAGCTGAATGCTGACGG - Intronic
987979228 5:25059165-25059187 CTTTATAAGGTGAGTGTTTGAGG - Intergenic
988490171 5:31699313-31699335 ATTTTTGAGCTGAATGTTGAAGG + Intronic
989467202 5:41770363-41770385 CTTAGTAGGGTCAATTTTGAAGG - Intronic
992828737 5:80573517-80573539 CGTTGTAATCTGAATGTTAAAGG + Intergenic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
1002304851 5:178277120-178277142 CTTTGGAAGGTCAATGTAGGAGG + Intronic
1004159812 6:13203633-13203655 GTTTGTGAGGTGGATCTTGAAGG + Intronic
1004169155 6:13282457-13282479 CTTTGGATGGTGCATGATGAAGG - Intronic
1007050093 6:38818606-38818628 AATTTCAAGGTGAATGTTGAAGG + Intronic
1008001857 6:46368807-46368829 CTTTATAAAGTGAATGTTCTAGG - Intronic
1010549529 6:77204090-77204112 CTTTGTAATGTGATTTTTTAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013505931 6:110800206-110800228 CTTTCTAACATGAATGTTAAAGG - Intronic
1014125677 6:117774524-117774546 CTTTGTAAGGAGAATGACTAAGG - Intergenic
1014318111 6:119892173-119892195 CTTTGTGAGGTCAAGGTAGATGG + Intergenic
1016551185 6:145281854-145281876 CTTTGGGAGGTGGATGTGGACGG - Intergenic
1016991970 6:149936440-149936462 CTTTGGAAGGCCAATGTTGGAGG + Intergenic
1017309348 6:152957807-152957829 TTTTGGAATGGGAATGTTGATGG + Intergenic
1017885090 6:158592399-158592421 CTTTGGAAAGTGAATGTAGTAGG + Intronic
1018152609 6:160954538-160954560 CCTGGGAAGGTGAAAGTTGAGGG - Intergenic
1020164504 7:5797359-5797381 CTTTGGAAGGTCAAGGCTGATGG + Intergenic
1020775369 7:12447664-12447686 CTTTGTAAGTTGCATGTTCTAGG - Intergenic
1021428698 7:20534678-20534700 CTTTGGAAAGTGCATGTGGATGG + Intergenic
1023662280 7:42482077-42482099 CTTAGTAATGTGTAAGTTGAAGG - Intergenic
1025028750 7:55538751-55538773 CTTTCTAAGGGGAATGCTGTGGG + Intronic
1025620787 7:63168717-63168739 CTTTGGGAGGTGAAGGTTGGGGG - Intergenic
1025942016 7:66081890-66081912 CTTTGGGAGGTGGATGTTCAAGG + Exonic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1029184255 7:98727310-98727332 TTCTGGGAGGTGAATGTTGAGGG - Intergenic
1029317373 7:99726785-99726807 CTTTGGAGAGTAAATGTTGAAGG - Intronic
1029471719 7:100758780-100758802 TTCTGTAAGGTGAGGGTTGAAGG + Intronic
1030276358 7:107725892-107725914 TTTTGATAAGTGAATGTTGATGG + Intergenic
1030314335 7:108098471-108098493 CTTTGTAAAGAGAACGTGGAAGG - Exonic
1034915862 7:155038432-155038454 CTTTGGCAGGTGCATGCTGAAGG - Intergenic
1036634753 8:10541178-10541200 CATGGTAGGGTGCATGTTGAAGG + Intronic
1043038511 8:75229526-75229548 TTTTGAAAGCTGAATGGTGATGG - Intergenic
1043413481 8:80024510-80024532 CTTTGTAAGGATAATGTGTATGG + Intronic
1043942863 8:86215442-86215464 CTTTGTGAGGTCAAGGTGGATGG + Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1046637873 8:116692287-116692309 CTTTATAAAGTGAATGGTAATGG - Intronic
1047567043 8:126056544-126056566 CTTTGTAATTTTAATGTTTAAGG + Intergenic
1048476715 8:134749522-134749544 CTTTGGGAGGTGATTGATGAGGG - Intergenic
1049178334 8:141207312-141207334 CTTTGCCAGGTGAATGTTTGTGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1055380186 9:75698254-75698276 CTTTTTAAGGTGAGTTTTTATGG + Intergenic
1060492026 9:124092106-124092128 GTTTGTTGAGTGAATGTTGAAGG + Intergenic
1061349058 9:130049468-130049490 CTTTGGGAGGTGAAGGTTGGAGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186730829 X:12407502-12407524 CCTAGTAGGGTGACTGTTGAGGG + Intronic
1187118448 X:16379060-16379082 CTTACCAAGGAGAATGTTGATGG - Intergenic
1187251557 X:17603087-17603109 CTTTGGAAGGTGAAAGTGGGAGG - Intronic
1188631101 X:32361539-32361561 TTTGGGAAGGTGAATTTTGAAGG + Intronic
1190182024 X:48200616-48200638 CTTTGAAAGGTCAAGGTGGACGG - Intronic
1190264867 X:48822424-48822446 CTGTGTAAGGTGGTTGTTGTGGG - Intronic
1192285257 X:69728302-69728324 TATGGTAAGGTGAATGTTGTAGG + Intronic
1193599960 X:83499611-83499633 CTTTTGTAGGTGATTGTTGAAGG - Intergenic
1193937249 X:87637703-87637725 CTTTGGAAGGTCAAAGTTGGAGG + Intronic
1197013449 X:121594494-121594516 CTTCCTAAGGTGACTTTTGATGG + Intergenic
1197221992 X:123923044-123923066 CTGTGCAAGGTGAATGATGGAGG + Intergenic
1197963182 X:132028106-132028128 CTTTGGAAGGCCAATGTGGATGG - Intergenic
1198679694 X:139168461-139168483 TTATGTTAGGTAAATGTTGAGGG + Intronic
1198778699 X:140210285-140210307 ATTTGTAATTTGAATGTTGGAGG + Intergenic
1198835503 X:140800560-140800582 GTTTGTAAGCTGAATTTAGAGGG - Intergenic
1200395177 X:155981832-155981854 ATTTTTAAGCTGAATGATGATGG + Intergenic
1202012367 Y:20357644-20357666 TTTTCTAAGGTGTATGTTGTGGG + Intergenic