ID: 916917049

View in Genome Browser
Species Human (GRCh38)
Location 1:169418247-169418269
Sequence AAATATCTACAAATGAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 1, 2: 7, 3: 60, 4: 775}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916917045_916917049 24 Left 916917045 1:169418200-169418222 CCTCTTCACTACAGCACTGTTAA 0: 1
1: 0
2: 1
3: 15
4: 205
Right 916917049 1:169418247-169418269 AAATATCTACAAATGAAGAATGG 0: 1
1: 1
2: 7
3: 60
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916917049 Original CRISPR AAATATCTACAAATGAAGAA TGG Intronic
900082841 1:872111-872133 AAATGTTAGCAAATGAAGAATGG + Intergenic
902538467 1:17135590-17135612 AAATATCAACAAAGGAAAAGGGG + Intergenic
902855994 1:19205723-19205745 AAAAGTCTTCAAAGGAAGAAAGG - Intronic
903697657 1:25220210-25220232 AAGTACCTAGAAATGGAGAAGGG - Intergenic
903735883 1:25529794-25529816 CTCCATCTACAAATGAAGAAAGG - Intergenic
904535058 1:31193980-31194002 AAATATCTCCAAACGAAGGAAGG - Intronic
904798885 1:33078995-33079017 AAGTATCTACCAATCAGGAAGGG - Intronic
906895937 1:49772051-49772073 AAATAACTAGAGAGGAAGAAAGG - Intronic
908023010 1:59917682-59917704 AAATATCTGCAAATGTAGGTTGG + Intronic
908216483 1:61959138-61959160 AAATCTATACAAATCATGAAAGG + Intronic
908427405 1:64020747-64020769 AAAGACCCACAAAAGAAGAAAGG + Intronic
908872202 1:68626289-68626311 AAATATCTGAAAGGGAAGAAGGG + Intergenic
908874788 1:68660724-68660746 AACTATATACAAATAAAAAAGGG + Intergenic
908909160 1:69052658-69052680 AAATATCTAAAAATAAATATTGG + Intergenic
909065218 1:70928112-70928134 AAATATATATATATGATGAATGG - Intronic
909095946 1:71289645-71289667 AAATATTCTCAAATGAAGATTGG + Intergenic
909617795 1:77632038-77632060 AAATTTCTCAAAATGAAAAAGGG - Exonic
909699372 1:78504684-78504706 ACATAAATACAAATGATGAATGG - Intronic
909872171 1:80755260-80755282 AAACATCTCCAAATCAATAAAGG + Intergenic
909898731 1:81107344-81107366 AAATATCTACCAGTCAAAAAAGG - Intergenic
910559279 1:88572966-88572988 AAATAACTACAAAAGAAGGCAGG - Intergenic
910774173 1:90858453-90858475 AAATATAAATAAATGAACAAAGG + Intergenic
911472874 1:98340027-98340049 ACATATCAACAAATAAAGCAAGG - Intergenic
911503235 1:98715218-98715240 AATAATCTTCAAATGTAGAATGG - Intronic
912019474 1:105088949-105088971 AAATGTCAACAACTGTAGAATGG - Intergenic
914320783 1:146557489-146557511 AAAGTTCTACATATTAAGAAAGG + Intergenic
915696679 1:157750073-157750095 AAACATTTAAAAATTAAGAATGG - Intronic
915985016 1:160455878-160455900 CAATATGTACAAAGGAAGAAAGG - Intergenic
915986206 1:160467453-160467475 ATATATACACAAAAGAAGAAAGG - Intergenic
916082891 1:161247072-161247094 GAATATAAACAAATGGAGAATGG - Intergenic
916350030 1:163838521-163838543 ATCTACCCACAAATGAAGAAGGG - Intergenic
916367154 1:164043196-164043218 AAAAATCTAAAAATGAATCAGGG + Intergenic
916397572 1:164408397-164408419 AAAGATCTACAAATAACCAATGG - Intergenic
916685722 1:167143795-167143817 AAATAAATACAAAGCAAGAAGGG - Intergenic
916917049 1:169418247-169418269 AAATATCTACAAATGAAGAATGG + Intronic
917198746 1:172493894-172493916 AATTATATAAAAATCAAGAAAGG - Intergenic
917918599 1:179729797-179729819 AAAAAAATACAAATGATGAAAGG - Intergenic
918618989 1:186580996-186581018 AAATAGCTTCCAATGCAGAAGGG + Intergenic
921501241 1:215905967-215905989 AAATAGCTACATATGAGCAAGGG + Intronic
921596424 1:217058574-217058596 AACTATTTAAAAATGAAGGAAGG + Intronic
922673732 1:227536517-227536539 AAATGTTAGCAAATGAAGAATGG - Intergenic
923330075 1:232915570-232915592 AAATGTGTACAGCTGAAGAAGGG - Intergenic
923907558 1:238402267-238402289 ATATTTTTACAAATGAAGAAAGG + Intergenic
924495034 1:244579664-244579686 AAAAATATACAAATGACCAATGG + Intronic
1062760752 10:16101-16123 AAATGTTAGCAAATGAAGAATGG + Intergenic
1063259148 10:4365242-4365264 AAATATTTACAAATTGAGAATGG + Intergenic
1063277194 10:4582739-4582761 AAATCTCAATAAATGAAAAAAGG - Intergenic
1064538620 10:16383864-16383886 AAATATCTAAAAAAGAACAGTGG + Intergenic
1065106967 10:22398787-22398809 AAATATTTGCAATTCAAGAAAGG + Intronic
1065279935 10:24125844-24125866 AAATATCTTCAAAAGGATAAAGG - Intronic
1066596785 10:37059662-37059684 ATATATTTACACATGAAGATAGG + Intergenic
1066788492 10:39034313-39034335 AAATATCTTCAGATAAAAAATGG - Intergenic
1066810140 10:39320696-39320718 AAATATCTTCAAATAAAAAGTGG - Intergenic
1066817562 10:39439633-39439655 AAATATCTTCACATGAAAACTGG - Intergenic
1067306586 10:45070403-45070425 TAACATTTCCAAATGAAGAAGGG - Intergenic
1067667203 10:48288725-48288747 ATTTATCTACCATTGAAGAAGGG + Intergenic
1067896814 10:50190907-50190929 TGATAACTACTAATGAAGAAGGG + Intronic
1067952157 10:50751126-50751148 TGATAACTACTAATGAAGAAGGG - Intronic
1068084605 10:52359579-52359601 AAAAATTTATACATGAAGAAAGG + Intergenic
1068831057 10:61495383-61495405 AAATAACTAAAAATGACAAAAGG + Intergenic
1069099327 10:64298781-64298803 AAATACCTTTAAAGGAAGAAAGG + Intergenic
1069332298 10:67307008-67307030 AAAAATGTAAAAATCAAGAAGGG + Intronic
1069586423 10:69606937-69606959 AAAACTCAACAAATGGAGAAGGG + Intergenic
1070183495 10:74037401-74037423 AAAGATCTACAGAAGCAGAAAGG - Intronic
1070449842 10:76547091-76547113 AAATAAATAAAAATGAAAAATGG - Intronic
1070953165 10:80446913-80446935 AAATATGTTTAAATGATGAAGGG - Intergenic
1071042610 10:81332511-81332533 AAAAATCAACTAATCAAGAAGGG - Intergenic
1071091216 10:81920877-81920899 ACATATATAAAAATGAACAAAGG - Intronic
1071536403 10:86435461-86435483 AAATATTTACAATGGAAAAAAGG + Exonic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1073817070 10:107219284-107219306 CATTATATAAAAATGAAGAAAGG + Intergenic
1074024714 10:109622453-109622475 TCATATCTGCAATTGAAGAATGG + Intergenic
1074584885 10:114758139-114758161 AAAAATTTAAAAAAGAAGAATGG - Intergenic
1074992582 10:118723467-118723489 AGATATGTAGGAATGAAGAAGGG - Intronic
1075148385 10:119903281-119903303 CCATAACTACAAATGAACAAGGG - Intronic
1075438988 10:122464437-122464459 AAATATTTGCAAAAGAAGGAGGG - Intronic
1076784081 10:132740695-132740717 ACATGTCTAGAAATAAAGAAGGG - Intronic
1077971208 11:7192945-7192967 AAATATCCACAACAGAGGAAAGG - Intergenic
1078048652 11:7942019-7942041 AAATAGGCACAAATGCAGAAGGG + Intergenic
1078418453 11:11185753-11185775 AAATCACTACAAATGTATAACGG - Intergenic
1080038555 11:27734899-27734921 AAAGAGCTACAGATGAAGGAAGG - Intergenic
1080101237 11:28462218-28462240 AATTTTCCAGAAATGAAGAAAGG + Intergenic
1080285978 11:30612632-30612654 AAATTTTTAAAAATGCAGAAAGG - Intergenic
1081182936 11:40006411-40006433 ACATATCTAGTACTGAAGAAAGG + Intergenic
1081202164 11:40229631-40229653 AAACACATACAAATGAAAAAAGG + Intronic
1081598403 11:44475213-44475235 AAAAATCAGCAAATGAGGAAAGG + Intergenic
1081883462 11:46474278-46474300 AAATACTTTCAAATGAATAAGGG + Intronic
1082153702 11:48775465-48775487 AAATATCTTCACATAAAGACTGG - Intergenic
1082153921 11:48778879-48778901 AAATATCTTCAAATTAAAAGTGG - Intergenic
1082156222 11:48818694-48818716 AAATATCTACACATAAAAACTGG + Intergenic
1082179379 11:49100076-49100098 AAATATCAAAAGATGAACAATGG - Intergenic
1082307457 11:50598095-50598117 AAATATCTTCAGATGAAAACAGG + Intergenic
1082313192 11:50680725-50680747 AAATATCTTCACATAAAAAATGG + Intergenic
1082573811 11:54777689-54777711 AAATATCTTCAAATAAAAACTGG + Intergenic
1082604696 11:55210825-55210847 AAATATCTTCAAATTAAAAGTGG - Intergenic
1082664601 11:55959873-55959895 ACATATTTACAAATGGAAAAAGG + Intergenic
1083399151 11:62411895-62411917 GAGTACCTACAAATGAAGAGTGG + Intronic
1084294175 11:68199885-68199907 AAATACCTGCAAATGAAGAATGG + Intronic
1084711189 11:70844748-70844770 TAAAATATTCAAATGAAGAAAGG - Intronic
1085984087 11:81764296-81764318 AAATGACTATAAATGATGAAAGG - Intergenic
1085994939 11:81900543-81900565 AAATATCTACAATTATAGACAGG + Intergenic
1086633156 11:89048673-89048695 TAATAAAAACAAATGAAGAAAGG + Intronic
1086986552 11:93256553-93256575 AAAATTCTACAAATGTAGAAAGG + Intergenic
1087603906 11:100351049-100351071 GAATTTCTACAAATCTAGAAAGG + Intronic
1088003085 11:104906380-104906402 AAAAATATACAAATTAAAAATGG + Intergenic
1088515059 11:110623755-110623777 AAATACCTACATATTAAGGAAGG + Intronic
1089836847 11:121378370-121378392 AAGTATCTTCAAATATAGAATGG - Intergenic
1090102440 11:123813898-123813920 AAATATATATATATGCAGAAAGG - Intergenic
1090996564 11:131871311-131871333 GAATAGCTACAAATGAAAATAGG - Intronic
1091729981 12:2873539-2873561 AAAAATAAATAAATGAAGAAGGG - Intronic
1091952051 12:4601447-4601469 AAACATCTACAAATGAAGAAGGG + Intronic
1092097243 12:5853050-5853072 AAATACCTATGAATAAAGAATGG + Intronic
1092681753 12:10990587-10990609 AAAAATCTAAAGCTGAAGAATGG + Intronic
1092694576 12:11155743-11155765 AAATACCTATAAATTAAGGAAGG - Intronic
1093095104 12:14963093-14963115 AAATATTTAAAAATGAAAAATGG + Intergenic
1093211100 12:16309949-16309971 AAGCATCTGCAAATAAAGAATGG + Intergenic
1093362025 12:18240922-18240944 AAATATCAACAAATTGAAAAAGG - Intronic
1093376635 12:18435911-18435933 AAGTATCTTCAAGTGAAGGAAGG - Intronic
1093598191 12:20987412-20987434 AAATATACACAACTGAAGACTGG - Intergenic
1093854897 12:24089829-24089851 AACCATCCAGAAATGAAGAAGGG - Intergenic
1093914859 12:24790113-24790135 AAACATGTACACATGAAGCATGG + Intergenic
1094044061 12:26147577-26147599 TAATATTTACACATGAAAAAAGG + Intronic
1094506600 12:31067078-31067100 AAATATCCACATTTGAAGATGGG - Intergenic
1094708519 12:32938106-32938128 AAATATCTACAGCTGCAGAATGG + Intergenic
1094868325 12:34567353-34567375 AAATATCTTCACATAAAGACTGG - Intergenic
1095031841 12:37296511-37296533 AAATATCTTCACATAAATAATGG + Intergenic
1095035762 12:37368375-37368397 AAATATCTTCACATAAAAAATGG - Intergenic
1095036583 12:37385870-37385892 AAAGATCTCCAAATGAACACTGG - Intergenic
1095057744 12:37635713-37635735 AAATATCTTCAAATAAAAAGTGG - Intergenic
1095068050 12:37807996-37808018 AAATATCTTCACATAAAAAATGG + Intergenic
1095074611 12:37902487-37902509 AAATATCTTCAGATGAAAACTGG - Intergenic
1095131775 12:38550765-38550787 AAAAAGCTAAAAATTAAGAATGG - Intergenic
1095406118 12:41869317-41869339 AAATATCTACACATGACCACAGG - Intergenic
1095631520 12:44382214-44382236 ATGTATGTACAAATGAAGACAGG - Intronic
1095656281 12:44672865-44672887 AAACATCTATAAAAGAAGATTGG - Intronic
1095857407 12:46875181-46875203 AAATATAAACAAAGGAAGGAAGG + Intergenic
1095995881 12:48084178-48084200 AAATATGTAAAAATGCATAAAGG + Intronic
1096721418 12:53525811-53525833 AAATTTCTTAAAATGTAGAAAGG + Intronic
1097217127 12:57422987-57423009 AAAAATATATAAATGAAGAATGG + Intronic
1097259323 12:57707025-57707047 AAATTTAGACAAATGAATAATGG - Intronic
1097475448 12:60050025-60050047 AAAAATCTAATAATTAAGAAAGG + Intergenic
1097673244 12:62567252-62567274 AAATAATCACCAATGAAGAAAGG - Intronic
1098388606 12:69945386-69945408 AAATATTTCTAAATGTAGAAAGG - Intronic
1098604771 12:72376871-72376893 AAATATCTAAAAAAAAAAAATGG - Intronic
1098874520 12:75853282-75853304 AAATAAATGCAAATGAAGTAGGG - Intergenic
1099017396 12:77360291-77360313 AAATATGTGCAAATGATTAAAGG - Intergenic
1099092333 12:78328515-78328537 CACTATTTAAAAATGAAGAATGG - Intergenic
1099203408 12:79701355-79701377 AAAGGTCTACAAATCAAGTAAGG + Intergenic
1100063453 12:90610238-90610260 AAATATCTGCAAATTAAGAAGGG + Intergenic
1100467219 12:94856894-94856916 AAACATCTAAAAATAAAGGATGG + Intergenic
1100568667 12:95824786-95824808 ACATATATACAAATTAGGAATGG + Intergenic
1100704394 12:97184535-97184557 AGAAATTTACAAATGAACAAAGG - Intergenic
1101262258 12:103045218-103045240 AAATAAATACAGCTGAAGAACGG - Intergenic
1101478131 12:105070895-105070917 AAATATTTACAAATAAAACATGG + Intronic
1101703622 12:107198985-107199007 AAAGATGTTCAGATGAAGAACGG + Intergenic
1102321599 12:111940305-111940327 AGATATATATATATGAAGAAGGG - Intronic
1102659830 12:114516398-114516420 AAATATTAAAAAATTAAGAAGGG + Intergenic
1103291588 12:119850658-119850680 AAATATTTACATTTAAAGAAAGG - Intronic
1103629452 12:122247860-122247882 AAATATTTAAAAAGAAAGAAAGG - Intronic
1104114874 12:125739675-125739697 AAGAATCTACAAATGTAGAATGG + Intergenic
1104387372 12:128362973-128362995 AAATATCAAAAGATGAAGAGAGG + Intronic
1105108765 13:16579609-16579631 AAATATCTTCAAATAAAAACTGG + Intergenic
1105110115 13:16601435-16601457 AAATATCTTCAAATAAAAACTGG + Intergenic
1105157492 13:17375261-17375283 AAATATCTTCAAATAAAAACTGG + Intergenic
1105533249 13:21239579-21239601 AAATATCTACAAAGATACAAGGG - Intergenic
1106047601 13:26158517-26158539 AAATATCTACTAGTAAAAAATGG + Intronic
1106341733 13:28836178-28836200 AAATATTTCCACATGAAAAATGG - Intronic
1106441671 13:29779509-29779531 TAATATTTAAAAATGATGAAAGG + Intronic
1106635696 13:31526205-31526227 AAATATCCACAAATGTGGCAGGG - Intergenic
1107063007 13:36181415-36181437 AAATATTTTAAAATGAAGGAAGG - Intronic
1107427717 13:40310497-40310519 AAATATCTTGAAAGGAAAAATGG + Intergenic
1107795837 13:44050844-44050866 AAATATCTTGAAATAAATAAAGG + Intergenic
1107867598 13:44717915-44717937 AAATATCTATATTGGAAGAATGG - Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108695166 13:52896646-52896668 AAACATCTTCAAATTAAAAAAGG + Intergenic
1108868092 13:54946480-54946502 AATGATCTATAAATGGAGAATGG - Intergenic
1109046626 13:57420913-57420935 AAATATCTCCACTTAAAGAAAGG + Intergenic
1109054966 13:57535257-57535279 AAACATATACAAATGTAGAAAGG + Intergenic
1109162959 13:58999279-58999301 AAATGTCAAAAGATGAAGAATGG + Intergenic
1109252347 13:60033956-60033978 ACATATCTATACATGAAGAAAGG - Intronic
1109633820 13:65086454-65086476 AAGTATCTATAAATGTAGAAAGG + Intergenic
1110100415 13:71594403-71594425 AAATATCTATAAAAGTAAAATGG - Intronic
1110317456 13:74127209-74127231 AAATATTTATAAATGCAGCATGG + Intronic
1110675707 13:78240991-78241013 AAACATCTAAAAGTGAAGACAGG + Intergenic
1110716077 13:78705693-78705715 AAATATCAATCAATGAAAAAAGG + Intergenic
1111287354 13:86112277-86112299 ATATATTTGCAAATGGAGAAAGG - Intergenic
1111328745 13:86734300-86734322 AAATATATAAAAATTAATAAAGG + Intergenic
1111401684 13:87745459-87745481 AAATAGCTACTATTGATGAAGGG - Intergenic
1111423541 13:88049887-88049909 AAATATATTTAAATGTAGAAGGG - Intergenic
1111513821 13:89300479-89300501 TAAGATTTACAAATGATGAAAGG - Intergenic
1111640097 13:90957776-90957798 AAATATCTACAAATAGAGCAAGG + Intergenic
1111773976 13:92635736-92635758 AATTATCTACAATTGATAAAGGG - Intronic
1111884354 13:94000646-94000668 AAATATCTACAAAATAGGCATGG + Intronic
1112201191 13:97277021-97277043 AAGTATCTACAATGCAAGAAGGG + Intronic
1112718479 13:102214401-102214423 AAATATATACAAATGTATATAGG + Intronic
1112809162 13:103197741-103197763 TCATTTCTACAAATGTAGAAAGG + Intergenic
1113033497 13:106021363-106021385 AAATAAGTAAAAATGAAAAATGG + Intergenic
1113364391 13:109662647-109662669 AATTAATTACAAAGGAAGAAAGG + Intergenic
1113847408 13:113400530-113400552 AAATAACTACAGCAGAAGAATGG - Intergenic
1113998788 14:16123977-16123999 AAATATCTTCACATAAAAAATGG - Intergenic
1114030843 14:18579213-18579235 AAATGTTAGCAAATGAAGAATGG - Intergenic
1114153761 14:20075467-20075489 AAAAATCAAAAAATAAAGAAAGG + Intergenic
1114469841 14:22952823-22952845 AAAAATCCACAAATAAACAAGGG + Intronic
1114553347 14:23546955-23546977 AGAAATCTACAAAAGAAGACAGG - Intronic
1115009876 14:28532878-28532900 CAATAGCAACCAATGAAGAAAGG - Intergenic
1115028847 14:28771074-28771096 AAATATACACAAATGGGGAATGG + Intergenic
1115039183 14:28900282-28900304 AAAGATCTACAATTGAATACAGG - Intergenic
1115131790 14:30062609-30062631 AAAGATGAAAAAATGAAGAAAGG - Intronic
1116045320 14:39735595-39735617 AAAGAACTACAAATCAATAAAGG + Intergenic
1116128642 14:40824254-40824276 AAATATCTCTAAAATAAGAAAGG + Intergenic
1116171576 14:41408928-41408950 AAATATATAGAGATGTAGAAAGG + Intergenic
1116508176 14:45711437-45711459 AAAAATTCACAAATTAAGAATGG - Intergenic
1116689843 14:48091548-48091570 AAATAGCTCTAAATGTAGAAAGG + Intergenic
1117303915 14:54454560-54454582 AAATATTTAAAAATAAGGAAAGG + Intergenic
1117743637 14:58845142-58845164 AGATAGCTGCAAATGGAGAAAGG + Intergenic
1117792894 14:59359380-59359402 ATGTTTCTACAATTGAAGAAGGG - Exonic
1117941383 14:60969948-60969970 AAATATTTACAAATGTATAAAGG - Exonic
1117963831 14:61187740-61187762 AAAAAAATACAAATTAAGAATGG + Intronic
1118228041 14:63921406-63921428 AAATATCTAGAAAAAGAGAAGGG + Intronic
1119124090 14:72108644-72108666 AAATAACTTCAAAAGTAGAAGGG - Intronic
1119385782 14:74257493-74257515 AGTTATTTACAAATGAATAAAGG + Intronic
1119578072 14:75746315-75746337 AAATGTCTACAAAAGATGAGTGG - Intronic
1119597828 14:75952609-75952631 AAATGTCCACAACTGATGAATGG + Intronic
1119978739 14:79055504-79055526 AAACATTGGCAAATGAAGAAAGG + Intronic
1120506075 14:85354555-85354577 AAATATATACAATTGAGAAAAGG + Intergenic
1120752030 14:88206639-88206661 CAATATCTCCAAATGCAGATTGG - Intronic
1121034752 14:90692106-90692128 ACATGTCTAGAACTGAAGAATGG - Intronic
1121591392 14:95114644-95114666 AAATATCTACTAATTATAAAAGG + Intronic
1122109754 14:99490592-99490614 AAATATTTACCAATAAGGAATGG - Intronic
1123156932 14:106235805-106235827 AAATATTTACAGATGAAATAGGG - Intergenic
1202928543 14_KI270725v1_random:17276-17298 ATATATCTACACATAGAGAAGGG + Intergenic
1123227917 15:17065118-17065140 AAATATCTTCACATAAAAAATGG + Intergenic
1123452997 15:20385011-20385033 AAAAATCATCAGATGAAGAACGG - Intergenic
1124125421 15:26934750-26934772 GAATAACTACAAAGGAAGTAAGG - Intronic
1124967158 15:34442869-34442891 AATTATCTACAATTGATAAAGGG - Intergenic
1126342976 15:47664146-47664168 AAATAGCTATAAATAAATAATGG - Intronic
1126916479 15:53472109-53472131 AAATATCATCAAATAAATAAAGG + Intergenic
1128219738 15:65960308-65960330 AAATATCTAACGAAGAAGAATGG + Intronic
1128595306 15:68940941-68940963 AAATAGCTCAAAAGGAAGAAAGG - Intronic
1129064956 15:72894525-72894547 ATACATCTACAAAACAAGAAAGG - Intergenic
1129750021 15:78056249-78056271 AAGTGTCTACAAAAGAACAAAGG + Intronic
1130679722 15:85985947-85985969 AAATGTCTACAAAAGTAAAAGGG - Intergenic
1131425425 15:92341836-92341858 GGATATGTACAAATGAAGAGAGG + Intergenic
1131640759 15:94290462-94290484 TAACCTCAACAAATGAAGAAGGG + Intronic
1131744363 15:95430098-95430120 AAATATATAGGAAGGAAGAAAGG - Intergenic
1131919801 15:97312553-97312575 AAATAACATTAAATGAAGAAAGG - Intergenic
1132307601 15:100827473-100827495 AAATCTGTAAAAATGAAGAATGG - Intergenic
1132785266 16:1653514-1653536 TAAAATGTACAAATGAAAAAGGG - Intronic
1133418782 16:5627599-5627621 AAATAACAACAAACTAAGAAGGG + Intergenic
1133466963 16:6036641-6036663 AAACATCTAAAAGTGGAGAAAGG - Intronic
1133542129 16:6766458-6766480 AAAGATTTAAAAATGAAGAAGGG - Intronic
1133883990 16:9809121-9809143 TAATATATACAAATGCAGACCGG + Intronic
1134175755 16:12004691-12004713 AAAATTCTACAAAAGAACAAGGG - Intronic
1134253401 16:12591126-12591148 CAAAATCTGAAAATGAAGAAAGG + Intergenic
1134295709 16:12943758-12943780 CAATATCTACAAATGGAGGCAGG - Intronic
1134694831 16:16215896-16215918 AAATAACTACAAGAGTAGAATGG - Intronic
1135021081 16:18963689-18963711 AAATAAATACAAATAAATAAAGG - Intergenic
1135534467 16:23282468-23282490 AAATAAGTACAGATAAAGAAAGG + Intronic
1135914519 16:26593681-26593703 AAATACCTCGAAATGAATAAGGG - Intergenic
1136745484 16:32586055-32586077 AAATATCTTCAGATAAAAAATGG + Intergenic
1136907516 16:34113325-34113347 AAATATCTTCACATAAAAAATGG + Intergenic
1136915201 16:34184204-34184226 AAATATCTTCACATAAAAAATGG - Intergenic
1137081435 16:36063298-36063320 AAATATCTTCACATGAAAAGTGG + Intergenic
1137294364 16:47076073-47076095 AATTATCTAAAAATGAATAAAGG - Intergenic
1137941342 16:52689913-52689935 AAATATTTACAGTTGAAGGATGG - Intergenic
1138311816 16:56031229-56031251 GAATTTCAACAAATGAAAAACGG + Intergenic
1140012751 16:71152616-71152638 AAAGTTCTACATATTAAGAAAGG - Intronic
1140771043 16:78204347-78204369 AAATAATCACATATGAAGAATGG + Intronic
1142539140 17:644051-644073 CAGTATCTCCCAATGAAGAATGG - Intronic
1143353043 17:6303335-6303357 AAGTACATAAAAATGAAGAAGGG - Intergenic
1144318473 17:14088172-14088194 AAATAGCTACTAATAAGGAATGG - Intronic
1145100051 17:20067446-20067468 AAAAATCTATATATTAAGAATGG - Intronic
1145874762 17:28308974-28308996 AAGTCTATCCAAATGAAGAAAGG + Intergenic
1146422711 17:32703638-32703660 ATATATCTACCAAAAAAGAAAGG + Intronic
1147010489 17:37442813-37442835 AAATGTTTACAAATGAGAAAAGG - Intronic
1148097430 17:45062368-45062390 ATATATCTACAAATATAGACAGG - Intronic
1149324071 17:55511870-55511892 ACATGGCAACAAATGAAGAAAGG - Intergenic
1149350025 17:55776996-55777018 GAATATTTAGAAATGTAGAAGGG + Exonic
1149552166 17:57548435-57548457 AAAGATCTGCCAAAGAAGAAAGG + Intronic
1149608466 17:57941598-57941620 AAACATCTACAAAAGTAGAGAGG - Intronic
1149631491 17:58128707-58128729 TAATACCTATAAATTAAGAATGG - Intergenic
1149648723 17:58262143-58262165 AACTCTCTAAACATGAAGAATGG - Intronic
1149744610 17:59083747-59083769 AAAGATCTGCAAATGAATAGAGG + Intronic
1150928222 17:69556530-69556552 AATTATATAAAAATCAAGAATGG - Intergenic
1151149695 17:72074474-72074496 AAAAATCTGCAAATGATGGAAGG + Intergenic
1152953659 18:16455-16477 AAATGTTAGCAAATGAAGAATGG + Intergenic
1152973847 18:193827-193849 AAATATCCACCAACGATGAATGG - Intronic
1153269802 18:3308799-3308821 AAATATTTACAAAAGCAGAAGGG - Intergenic
1155103322 18:22635958-22635980 AGATATCTACCAATGACAAAGGG + Intergenic
1155123999 18:22853374-22853396 AAATATGTACAAATAAGTAAGGG - Intronic
1155410224 18:25535914-25535936 AAATTTCTGCAACCGAAGAAGGG + Intergenic
1155944454 18:31832821-31832843 TAACATGTACAAATGAAGCAGGG + Intronic
1156603410 18:38637825-38637847 AAATATCTACAATGGATGACTGG + Intergenic
1156642305 18:39117226-39117248 AAAAATCCATAATTGAAGAAGGG + Intergenic
1156949916 18:42882959-42882981 TAATATATACAAATGTATAAGGG - Intronic
1157139228 18:45088898-45088920 AAATATGGAGAAAGGAAGAAAGG - Intergenic
1157300949 18:46478669-46478691 AAATACATAAAAATGAATAAAGG - Intronic
1158131000 18:54152599-54152621 AAATGTCTACAAAAGAAATAGGG + Exonic
1158497714 18:57971288-57971310 AAATAACCACCAAAGAAGAAAGG - Intergenic
1159335200 18:67054689-67054711 AAATATCTAGAAAAGTAAAAGGG + Intergenic
1159587760 18:70297860-70297882 AAGTACATCCAAATGAAGAATGG - Intronic
1160167799 18:76529415-76529437 AAATAACGAAGAATGAAGAAAGG - Intergenic
1161940561 19:7400844-7400866 AAATATTTATAAATGAAAAGAGG + Intronic
1162839762 19:13347824-13347846 AAACATCTATGAATGAAAAAGGG + Intronic
1164328236 19:24222464-24222486 AAATATCTTCAGATAAAAAATGG - Intergenic
1164332112 19:24269474-24269496 AAATATCTCCAAATAAAAACAGG - Intergenic
1164337646 19:24345698-24345720 AAATATCTTCAGATGAAAACTGG + Intergenic
1164356999 19:27447903-27447925 AAATATCTACAGATAAAAACTGG + Intergenic
1164414581 19:28035970-28035992 AAAATTATAGAAATGAAGAATGG + Intergenic
1165642231 19:37399493-37399515 AAATACCTAAAAATGTGGAAGGG - Intergenic
1166924534 19:46257978-46258000 AAACATCTTCAAATGTATAAAGG - Intergenic
1167388071 19:49176222-49176244 AAATACCTAAAAATGAATTAAGG - Intronic
1168376194 19:55881867-55881889 AAATTTATACAAATAAAAAAAGG - Intergenic
1168609374 19:57786904-57786926 AAAGATGTTCAAAGGAAGAACGG + Intronic
1168635810 19:57996071-57996093 AAAAATTTAGAAATGAAAAAGGG + Intronic
925061985 2:898409-898431 AAATATCTAGAAAAGGAGCAGGG + Intergenic
925255265 2:2479523-2479545 AAATAACAACAAAAGAACAATGG - Intergenic
925408064 2:3620195-3620217 AAAAATCTCCAATCGAAGAAAGG - Intronic
925621186 2:5794354-5794376 CAATTTCTACAAAACAAGAAAGG - Intergenic
925662769 2:6220479-6220501 AAACAACTAAAAATTAAGAAAGG + Intergenic
926315951 2:11709695-11709717 AAAAATCTACAAATGAACGTTGG + Intronic
927059697 2:19405183-19405205 AAATGTCTTCAAATCAATAAAGG + Intergenic
928808716 2:35195815-35195837 AAATTTATATAAGTGAAGAAAGG + Intergenic
929010090 2:37433319-37433341 AAATATACACAACTGCAGAATGG - Intergenic
929112183 2:38414242-38414264 AGATATACACAAAAGAAGAAAGG + Intergenic
929375738 2:41284566-41284588 AGATTTCTACCAATGAAGCAGGG - Intergenic
929657380 2:43747589-43747611 AAATATTTAAAAAGAAAGAAAGG - Intronic
929742151 2:44614014-44614036 AGATAAATACAAATGTAGAAGGG + Intronic
930423567 2:51183877-51183899 AAATGTCCACAACAGAAGAATGG - Intergenic
931324044 2:61199828-61199850 AAACATCTACATTTGAAAAAAGG + Intronic
931399104 2:61914241-61914263 AAATATCTACAAATTGGAAATGG + Intronic
932897581 2:75656992-75657014 GAACTTCTACAAATCAAGAAGGG - Exonic
933164425 2:79060356-79060378 AAATATACACCAATTAAGAATGG - Intergenic
934877399 2:97937134-97937156 AAATATGTTCAAAGGAAAAAAGG + Intronic
935448776 2:103186458-103186480 AAAAATTTAAAAATGGAGAAAGG + Intergenic
935660554 2:105463186-105463208 AAATATTAAAAAATGAAGAGGGG - Intergenic
935974957 2:108569249-108569271 AAATATTTGCAAATCATGAATGG - Intronic
936485471 2:112921832-112921854 AGATTTTTATAAATGAAGAAAGG + Intergenic
936999194 2:118448617-118448639 AAATATCAAAGCATGAAGAAGGG - Intergenic
937116865 2:119412698-119412720 AAATATTTACATGTGAATAATGG - Intergenic
937235499 2:120429614-120429636 AAGTCTCTAAAACTGAAGAAAGG - Intergenic
937480498 2:122253350-122253372 AAATATACAGAATTGAAGAATGG + Intergenic
937627303 2:124057597-124057619 ATATATCTATGAATTAAGAATGG - Intronic
937748341 2:125442681-125442703 AAAACTCAAAAAATGAAGAAAGG + Intergenic
937776453 2:125782636-125782658 AAACATTTACAAAGAAAGAAGGG - Intergenic
937828304 2:126391815-126391837 ATATATTTAGAAATGAAGATTGG - Intergenic
937958403 2:127436919-127436941 AAACATGTACAAATCAAGGATGG - Intronic
938191175 2:129282122-129282144 AGATATCTACAAATCAATATGGG - Intergenic
938497362 2:131806560-131806582 AAATGTTAGCAAATGAAGAATGG + Intergenic
939238265 2:139525548-139525570 AAATGTCTACCTCTGAAGAAAGG + Intergenic
939286660 2:140140156-140140178 AAATAACTAAAAATGTAGAAAGG + Intergenic
939518208 2:143195970-143195992 AAATAGATAAAAATGAAAAAGGG + Intronic
939585933 2:144005724-144005746 AAAAATATACAAAGGAAGACAGG + Intronic
939602445 2:144209636-144209658 AATTATATTCAAATGAAAAATGG - Intronic
939747028 2:145985967-145985989 AAATGTCTGCAAATGTAAAAGGG + Intergenic
939830681 2:147066778-147066800 AAATGTTTTCAAATGAACAATGG + Intergenic
940112368 2:150169026-150169048 AAATATCTCCATATGGGGAAGGG - Intergenic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
940599112 2:155835136-155835158 AAATACCTGCAAAAGAGGAAGGG + Intergenic
940935094 2:159483925-159483947 AAATATGTGCAAAAGATGAAGGG + Intronic
941078858 2:161036883-161036905 AAATATCTGAAAATCAAAAAAGG - Intergenic
941683288 2:168421883-168421905 AAATATCATCAAATGACAAATGG - Intergenic
941861850 2:170290764-170290786 AAATAACCACAAAGGAAGACAGG - Intronic
941947967 2:171121125-171121147 AAATTTCTACAGATGAATAGTGG + Intronic
942153235 2:173099636-173099658 AAATAATTACAGCTGAAGAATGG - Intronic
942287676 2:174437122-174437144 AAGTATGTACAAATAAACAAAGG + Intronic
943018238 2:182540697-182540719 AACTGTGTACATATGAAGAAAGG - Intergenic
943194330 2:184724437-184724459 GATTATCTAAAAATGAAGACAGG + Intronic
943998311 2:194799301-194799323 AAAATTATAGAAATGAAGAAAGG - Intergenic
944116922 2:196197255-196197277 AAATATCTTATAATGAAGATAGG - Exonic
944497498 2:200323450-200323472 AAATATTTTCAAATGAAGTATGG + Intronic
945155899 2:206837157-206837179 AAATATAGACAAATGAGGATTGG + Intergenic
945323534 2:208455740-208455762 AAATATCTTCAAAGGATGAATGG + Intronic
945336310 2:208596781-208596803 AAATATCTTAAATAGAAGAAAGG + Intronic
946047297 2:216831887-216831909 AAATAAATAAAAATGAAAAAAGG + Intergenic
946415605 2:219538354-219538376 AAATATTTACAAATGTACAGAGG - Exonic
946723661 2:222639432-222639454 AAAAATCTGCAGAGGAAGAAAGG + Intronic
947098409 2:226592370-226592392 AAATATCTATGAAAGAAGCATGG + Intergenic
947898209 2:233694992-233695014 AAATAGCTAGAAATGAAGAATGG - Intronic
1169051990 20:2586877-2586899 AAATACCTAAAAATAAATAATGG - Intronic
1169541874 20:6608241-6608263 CCACATCTACAAATTAAGAATGG - Intergenic
1169687499 20:8291570-8291592 AAATATCAACAAATAAATCATGG - Intronic
1170802069 20:19598727-19598749 CAATATCTTAAAATGACGAAGGG - Intronic
1171366984 20:24631723-24631745 ATATATATATAAATCAAGAAAGG - Intronic
1171574647 20:26294558-26294580 AAATATCTTCACATGAAAACTGG + Intergenic
1171734406 20:28757406-28757428 AAATATCTTCACATAAAAAATGG - Intergenic
1171742679 20:28919495-28919517 AAATATCTTCACATAAAAAATGG - Intergenic
1171762792 20:29224649-29224671 AAATATCTTCACATAAAAAATGG + Intergenic
1171765924 20:29276252-29276274 AAATATCTTCACATGAAAACCGG - Intergenic
1171934333 20:31259394-31259416 AAATAAATACAATTAAAGAAAGG - Intronic
1172382527 20:34507446-34507468 CAATATTTAAAAATGAACAAAGG - Intronic
1173007802 20:39154091-39154113 AAAGGTGTACAAATGAACAAAGG + Intergenic
1173090426 20:39965388-39965410 AAATAATTTCAAATGGAGAAAGG - Intergenic
1174652433 20:52138748-52138770 AAATAGATACAAACTAAGAAAGG + Intronic
1174753612 20:53136801-53136823 AAAAATCTACTGAGGAAGAAGGG + Intronic
1174849872 20:53983359-53983381 AAATGAATACAAATGAAGTAAGG - Intronic
1174884618 20:54319327-54319349 AAATATCTACAAATGATATATGG + Intergenic
1175672170 20:60913141-60913163 AAGTAACTACAAATGAAGTAAGG + Intergenic
1176322232 21:5340873-5340895 AAATATCTTCACATGAAAACTGG + Intergenic
1176323708 21:5364078-5364100 AAATATCTTCAAATAAAAACTGG + Intergenic
1176324715 21:5381781-5381803 AAATATCTTCACATAAAAAATGG + Intergenic
1176479888 21:7272659-7272681 AAATATCTTCACATGAAAACTGG + Intergenic
1176481469 21:7298081-7298103 AAATATCTTCAAATAAAAACTGG + Intergenic
1176482267 21:7312197-7312219 AAATATCTTCACATAAAAAATGG + Intergenic
1176761458 21:10798583-10798605 AAATATCTTCACATAAAAAATGG + Intergenic
1176976680 21:15328505-15328527 AAATATCTAACAATAAACAAAGG - Intergenic
1177031791 21:15989350-15989372 AAATATCAAAAGATTAAGAATGG - Intergenic
1177551851 21:22633184-22633206 AAATATTTACAAATAAAGAGAGG + Intergenic
1177588924 21:23136279-23136301 AAATATCTTCAAAGAAATAACGG - Intergenic
1177922232 21:27166617-27166639 AAATATATACAAACAAAGCAAGG - Intergenic
1178013113 21:28309947-28309969 AAAAATCAGAAAATGAAGAAAGG + Intergenic
1178080074 21:29054334-29054356 AAATACCTAAAAATGTACAAAGG + Exonic
1178129446 21:29555096-29555118 CAATAGCTACAAATACAGAAAGG + Exonic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178973301 21:37200371-37200393 AAATATTTTCAAAATAAGAAAGG + Intronic
1180273397 22:10622952-10622974 ATATATCTACACATAGAGAAGGG + Intergenic
1180398293 22:12379712-12379734 AAATATCTTCACATGAAAACTGG + Intergenic
1180398386 22:12381250-12381272 AAATATCTTCACATGAAAACTGG + Intergenic
1180401153 22:12427421-12427443 AAATATCTTCACATAAAAAATGG + Intergenic
1180454957 22:15506269-15506291 AAATGTTAGCAAATGAAGAATGG - Intergenic
1181716112 22:24730696-24730718 AAATATCTAAAAAAAATGAAAGG + Intronic
1181830347 22:25555503-25555525 AATTATCTAAAGATGAGGAAAGG - Intergenic
1183348922 22:37323903-37323925 AAATCTCTAGCAATCAAGAACGG - Intergenic
1183640792 22:39091164-39091186 AAATATGTATAAATAAAGAGTGG - Intergenic
949369794 3:3322314-3322336 AAATATTAACATATGCAGAAAGG + Intergenic
949418600 3:3840152-3840174 AACACTCAACAAATGAAGAATGG - Intronic
950832297 3:15886736-15886758 AAATACCTACAAATGTGGAGTGG + Intergenic
950906353 3:16542335-16542357 AAATTTTGACAAATAAAGAAAGG - Intergenic
951338812 3:21458546-21458568 AAATCTCTACCAATGATGAAAGG + Intronic
951440453 3:22717188-22717210 AAATATCTACATAATAATAAAGG - Intergenic
951525026 3:23645417-23645439 AAATATCTTGGAATAAAGAAAGG - Intergenic
951601013 3:24375923-24375945 AAATATAGACAAATTAGGAAAGG + Intronic
951750213 3:26026740-26026762 AAATATATTCAAAGAAAGAATGG - Intergenic
951779786 3:26349446-26349468 AAATATCTAATATTGAATAATGG - Intergenic
951799437 3:26578799-26578821 AATTATCTTCAAATGATAAAAGG - Intergenic
951954068 3:28234731-28234753 AACAACCTTCAAATGAAGAAAGG - Intergenic
952620567 3:35335259-35335281 AAAGATATAATAATGAAGAAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953334408 3:42081436-42081458 AAATAACAACAAATGAAAGAAGG - Intronic
953498972 3:43414534-43414556 GAATTTCTAGAAATGAAGAGTGG - Intronic
953511789 3:43548717-43548739 AAATATCTAAAAATGAAAGGTGG + Intronic
955085562 3:55699121-55699143 ACATATCTATGAAAGAAGAAAGG + Intronic
955883918 3:63577404-63577426 CAATAGCTATATATGAAGAAAGG + Intronic
955994392 3:64664664-64664686 AAATGTCCACCAATGATGAATGG - Intronic
956562965 3:70602539-70602561 ATATAACTTCAAATGAATAAAGG + Intergenic
956691261 3:71879699-71879721 AAATATCTAAAAATAAGGGATGG + Intergenic
956896135 3:73662103-73662125 ACATATCTCCAAATGATGGAAGG - Intergenic
957354902 3:79069374-79069396 GAATAAATACAAATAAAGAATGG - Intronic
957758666 3:84525617-84525639 AAATTTCTACCTCTGAAGAAAGG + Intergenic
957761117 3:84558062-84558084 GAAGATCTAATAATGAAGAATGG + Intergenic
958070285 3:88601569-88601591 GAATATTTACAAATCAAAAATGG - Intergenic
958076138 3:88681115-88681137 ATATATCTAGAGATGAAGCAAGG + Intergenic
958501934 3:94922278-94922300 AAAAATGAACAAGTGAAGAAAGG - Intergenic
958616775 3:96503611-96503633 CAATATCTAGAAATGAACCATGG + Intergenic
958835100 3:99136349-99136371 AAATATAAACAATAGAAGAATGG - Intergenic
958864419 3:99484654-99484676 AAATATGTCCAAATCAAAAATGG - Intergenic
959331911 3:105017079-105017101 AAATATCATCAAAGAAAGAAAGG + Intergenic
959370580 3:105520496-105520518 GAACATGAACAAATGAAGAAAGG - Intronic
959601853 3:108195973-108195995 AAATACCTAAAAATGTGGAACGG + Intronic
959679545 3:109077712-109077734 AAATAACAACAAAAGAAGCAAGG + Intronic
960822047 3:121744713-121744735 AAATATGTACATTTTAAGAAAGG + Intronic
961255466 3:125547032-125547054 ATATATCTAATCATGAAGAATGG - Intronic
961480910 3:127180030-127180052 AAATATTAACAAAAGAAGGAGGG + Intergenic
962139787 3:132777123-132777145 AAACATCTATCAATGATGAATGG - Intergenic
962230053 3:133656823-133656845 AAATATGTACAAATGATGGGCGG - Exonic
962450387 3:135510008-135510030 AAATAACAAGAAATGAAGCAAGG + Intergenic
963522837 3:146377733-146377755 AAATGTTTACCAATGAAGATGGG - Intergenic
963614147 3:147513747-147513769 AACTATGTACAAGTGAAAAAGGG + Intergenic
963645296 3:147906056-147906078 AAATATCCATATATAAAGAAAGG + Intergenic
963723662 3:148893928-148893950 AAATATTCAGAAATGAAGGAGGG + Intronic
963766809 3:149345348-149345370 AAATATCTACTTATGGAGGAGGG - Intergenic
964506989 3:157410353-157410375 AAATGTCAACAAAGAAAGAAAGG - Intronic
965315573 3:167185872-167185894 AAATGTCCACCAATGAGGAAAGG - Intergenic
965472224 3:169108874-169108896 AAATATAAAAGAATGAAGAAAGG + Intronic
965659361 3:171024674-171024696 CAGTTTCTACAACTGAAGAATGG - Intronic
965866067 3:173205449-173205471 AAATACCTGGAAGTGAAGAAAGG + Intergenic
966034008 3:175387896-175387918 AGATATCTTCAAATGTAAAATGG - Intronic
966097004 3:176215763-176215785 AATTATCTACAAATGTAAGATGG + Intergenic
967004506 3:185371244-185371266 ACAATTATACAAATGAAGAAGGG - Intronic
967613021 3:191530659-191530681 AAATATATAAAAATGAAAATAGG - Intergenic
967880821 3:194300001-194300023 AAATATATACAAATCAAAGAAGG - Intergenic
968219384 3:196924372-196924394 AAACTCCTACAAATGAATAAGGG + Intronic
968257706 3:197292613-197292635 TAGTATCTACAAATAAAGATAGG + Intronic
970226115 4:13858770-13858792 GAATATAAACAAATCAAGAAGGG + Intergenic
970372332 4:15420586-15420608 AAAAATATCCAAATGAAGTAAGG - Intronic
970645259 4:18113167-18113189 AATTATCAAAAAATAAAGAATGG - Intergenic
970990339 4:22206463-22206485 AAATATATATAAAAAAAGAAAGG - Intergenic
971488235 4:27184100-27184122 AAATTTCTAACAATAAAGAAAGG - Intergenic
971751125 4:30649635-30649657 AAATATCATCAACTAAAGAACGG + Intergenic
971767498 4:30852271-30852293 ATATATCTACATATAAACAAAGG - Intronic
971944798 4:33260497-33260519 AATTATCTTCAAATGTAGCATGG - Intergenic
972526678 4:39919688-39919710 AAATATGAGCAAATGAACAATGG + Intronic
972986199 4:44768939-44768961 AAATGTCTACGAAAGGAGAATGG + Intergenic
973071505 4:45865206-45865228 AAATATATAAAAATCCAGAAAGG + Intergenic
973273244 4:48282301-48282323 AAAGATCAAAAAATAAAGAAGGG + Intergenic
973407930 4:49768684-49768706 AAATATCTTCAAATAAAAACTGG + Intergenic
973495683 4:51218535-51218557 AAATATCTTCAAATAAAAACTGG + Intergenic
973523812 4:51681160-51681182 AAATATCTTCAAATAAAAACTGG + Intergenic
974530731 4:63104674-63104696 AAATAACTACAACTGCAGCATGG - Intergenic
974554099 4:63420883-63420905 ACATATCTACAAAAGAAAAAAGG - Intergenic
975268418 4:72398609-72398631 AAGTATCTACAAAGGATGAAAGG + Intronic
975391603 4:73824217-73824239 AAATGTCCACAATTGAAAAATGG - Intergenic
975646396 4:76550215-76550237 AAATATCAACAAAGGAAACACGG - Intronic
976183714 4:82423847-82423869 AAATATTTACATATTCAGAAAGG - Exonic
976294688 4:83458224-83458246 AAATATGTACACAGTAAGAAAGG + Intronic
977882840 4:102225545-102225567 CAGTACCTACAAATGAAGCAGGG - Intergenic
978395797 4:108278500-108278522 AAGAATCTACAAGTGAAGCAGGG - Intergenic
978883256 4:113733926-113733948 AAATATGTACAAATGAGAACAGG + Intronic
979174520 4:117646641-117646663 CAATAACAACCAATGAAGAAAGG - Intergenic
979303602 4:119115962-119115984 AAATATAAACAAAAAAAGAAAGG + Intergenic
979361258 4:119767687-119767709 AAATATGTAGAAAGAAAGAAAGG + Intergenic
979521129 4:121668204-121668226 AAATATATATAAATGGAAAATGG + Exonic
979778859 4:124624191-124624213 AAATATCTAAAAATGTGGAATGG - Intergenic
979839165 4:125416637-125416659 AATTATCTACAAATGAACAAGGG - Intronic
979935449 4:126688793-126688815 AAATATTGGCAAATGAAAAAGGG - Intergenic
980500356 4:133643503-133643525 AAATATCTACAAAAGAGTACAGG - Intergenic
980682763 4:136186196-136186218 AAAAATCTACAAATAACCAAAGG + Intergenic
981043272 4:140242850-140242872 GAATATCAAGAAAGGAAGAATGG + Intergenic
981070451 4:140530380-140530402 AAAGATATACAAAAGAAGACTGG + Intronic
981549716 4:145931710-145931732 GGATATTTAAAAATGAAGAATGG + Intronic
981886479 4:149679497-149679519 AAATAGCTAGAAGAGAAGAATGG + Intergenic
982125366 4:152179513-152179535 AAATATCCAGAAAAGAAAAATGG - Intergenic
982146852 4:152403958-152403980 AAATATCTTCAAAACAAGAACGG + Intronic
982545902 4:156732652-156732674 AAATGTATTCAAATAAAGAACGG + Intergenic
982666243 4:158268027-158268049 AAATTTCTACAAATGTTTAATGG + Intergenic
982762618 4:159304691-159304713 AAATTTATACAAATAAAAAAAGG - Intronic
982873760 4:160617904-160617926 AAATATCTACAAAGTTACAATGG - Intergenic
983316676 4:166141636-166141658 AAATATTTTAAAATTAAGAAAGG + Intergenic
983665330 4:170175958-170175980 AAATATCTACATTTTAAGACAGG - Intergenic
983696247 4:170535394-170535416 AAATGTCCACAAATGAGTAATGG + Intergenic
983737150 4:171075693-171075715 TAAAAGCTATAAATGAAGAAGGG - Intergenic
983779906 4:171655662-171655684 ATATATTTACAAATGCACAATGG - Intergenic
984037156 4:174683815-174683837 AAATATCTACAAAGCAAAAATGG + Intronic
984190482 4:176600179-176600201 AAATTTTTAAAAATGAACAAAGG - Intergenic
984256248 4:177393116-177393138 AAAGCTGTAAAAATGAAGAAAGG + Intergenic
984572951 4:181415252-181415274 TTATACCTACAAATGTAGAAAGG + Intergenic
984585445 4:181559167-181559189 AATTATCCACTAATGACGAAGGG + Intergenic
984616869 4:181908112-181908134 AAATAAATGCAAAGGAAGAAAGG - Intergenic
985830832 5:2228257-2228279 AAAAATTTACAAATAAAAAAAGG + Intergenic
986150519 5:5125612-5125634 AAATATTTATAAATGTAGATAGG + Intergenic
986562531 5:9076613-9076635 AAATTTGTACAAATAAAAAATGG + Intronic
987060013 5:14233523-14233545 AAATATTTACTAAAGGAGAAGGG - Intronic
987380070 5:17276495-17276517 AAATATCTGGAGAGGAAGAATGG - Exonic
987639641 5:20596058-20596080 AAATATCCCCAAATGAAGAGTGG - Intergenic
987666090 5:20942199-20942221 AAATGTCTACTAATGGGGAAAGG + Intergenic
987701138 5:21399896-21399918 ATTTATCAACAAATGAAGAAAGG + Intergenic
987914415 5:24192626-24192648 AAAAATCAAGAATTGAAGAATGG + Intergenic
988140177 5:27228003-27228025 AAATATCTAGAAAAAAGGAAAGG + Intergenic
988259830 5:28871695-28871717 AAATTTATACAATTTAAGAAAGG - Intergenic
988649201 5:33129887-33129909 GAATATCTCCAACTGATGAATGG + Intergenic
988756597 5:34259972-34259994 AAATGTCTACTAATGGGGAAAGG - Intergenic
989149340 5:38283205-38283227 GAATATCTGCAATTGGAGAACGG - Intronic
989384921 5:40845540-40845562 AAATAAATAAAAATTAAGAATGG - Intronic
989640984 5:43582903-43582925 AAATATCCAAAACGGAAGAAAGG - Intergenic
989831189 5:45921742-45921764 AAATATCTACAGATAAAAACTGG - Intergenic
989833637 5:45954325-45954347 AAATATCTTCAGATAAAGACTGG + Intergenic
989837729 5:46014561-46014583 AAATATCTACAGATAAAAACTGG + Intergenic
989838346 5:46025441-46025463 AAATATCTTCAGATAAAAAATGG + Intergenic
989840678 5:46063663-46063685 AAATATCTTCAGATAAAAAATGG + Intergenic
989846245 5:46146374-46146396 AAATATCTTCAGATGCAAAATGG + Intergenic
989846687 5:46153106-46153128 AAATATCTTCACATAAAAAATGG + Intergenic
989853878 5:46253649-46253671 AAATATCTTCAAATAAAAACTGG - Intergenic
989854701 5:46268656-46268678 AAATATCTACAGATAAAAACTGG - Intergenic
989855661 5:46286102-46286124 AAATATCTTCAGATTAAAAATGG - Intergenic
989856105 5:46294327-46294349 AAATATCTTCAGATAAAAAATGG - Intergenic
989856271 5:46296897-46296919 AAATATCTACAGATAAAAACTGG - Intergenic
989858279 5:46328975-46328997 AAATATCTTCACATAAAAAAAGG - Intergenic
989858377 5:46330851-46330873 AAATATCCTCAAATAAAAAATGG - Intergenic
989943280 5:50181380-50181402 AAATATCTTCAAATAAAAATTGG - Intergenic
990889902 5:60636571-60636593 AAATATCTACATATGTAGGTTGG - Intronic
991043851 5:62202543-62202565 AAATTTCTTCAAATCCAGAAAGG + Intergenic
991137446 5:63198704-63198726 AAGTATGTAAATATGAAGAATGG + Intergenic
991249380 5:64543096-64543118 ATCTATCTACAAAAGAAAAATGG + Intronic
991369757 5:65905869-65905891 AAATATATACAAATACATAAAGG + Intergenic
991577534 5:68120884-68120906 AAATATATACAAAAGATTAAAGG + Intergenic
991640696 5:68748877-68748899 AAAGTTCTTCAATTGAAGAATGG - Intergenic
992106835 5:73455925-73455947 GAATAGATACAACTGAAGAATGG + Intergenic
992117091 5:73549441-73549463 CAATATCTACAAATGAAATTTGG + Intergenic
992386591 5:76290485-76290507 AAATAGAAAAAAATGAAGAATGG - Intronic
992462872 5:76978784-76978806 AAATAACAACAAATTTAGAATGG + Intronic
993144105 5:84072177-84072199 AAATAAATACAAATGACAAATGG + Intronic
993275150 5:85847886-85847908 AATTAACTATAAATTAAGAAAGG - Intergenic
993303312 5:86241953-86241975 AAATGTCTACAAAGAAAAAAAGG - Intergenic
993505045 5:88698782-88698804 TAATATATACAAATGAAGAATGG - Intergenic
993609247 5:90033906-90033928 AAATATCAACAAAGAAAAAAAGG + Intergenic
993653987 5:90556023-90556045 AAATATAAAGAAATGAAAAATGG + Intronic
993712282 5:91237615-91237637 AAATAACCAAAAATTAAGAAGGG + Intergenic
994679166 5:102864155-102864177 ATATATATATATATGAAGAAGGG - Intronic
994784813 5:104144311-104144333 AAACATCTAAAAATTAAAAATGG + Intergenic
995673248 5:114632179-114632201 AAAGATCTCAAAATGGAGAAAGG - Intergenic
996215920 5:120865661-120865683 AAATTTCTACAAAAAAAAAATGG - Intergenic
997261507 5:132468979-132469001 AAATGTCTACTTATGCAGAAGGG + Intronic
997289326 5:132714679-132714701 AAATTTCTAGAAATGAATAGTGG + Intronic
997449499 5:133970397-133970419 AAATATTTAAAAATGTATAAAGG - Intergenic
997605048 5:135168864-135168886 AAGTATCTGGACATGAAGAAAGG - Intronic
997884746 5:137620150-137620172 AAATGTCTCCAAAGGAAGCAAGG - Exonic
998543053 5:143001489-143001511 AAATATGAACAACTGTAGAATGG + Intronic
998624729 5:143833412-143833434 CCATATCTACAAATGAAGGGGGG - Intergenic
998729942 5:145063231-145063253 AAATATATTCAAATGATTAAAGG + Intergenic
998829568 5:146142719-146142741 AAATATGTACTAAAGCAGAAAGG - Intronic
999067168 5:148700135-148700157 CAATATCTTCAATTGCAGAAAGG + Intergenic
999475482 5:151894349-151894371 AAATGTTTGCAAATGAGGAAGGG - Intronic
999699254 5:154213268-154213290 TAATCCCTACAAATGAAGAGTGG - Intronic
999879191 5:155842085-155842107 TAATATCTAGAAAAGAAGAGAGG + Intergenic
1000092904 5:157945808-157945830 AAATATATAAAAAAGAAGGAAGG - Intergenic
1000128578 5:158272293-158272315 ACATTTCTTCAAAGGAAGAAAGG + Intergenic
1000137268 5:158364923-158364945 AAATCTGTTCAAATGAAGAGGGG + Intergenic
1000158958 5:158581382-158581404 ATACAACTACAAATGAAAAAGGG - Intergenic
1000366872 5:160500035-160500057 GAAAATCTACAAATGGAGAGGGG + Intergenic
1000489836 5:161897744-161897766 ATATATCTACAAATGACCTAGGG - Exonic
1002675644 5:180910283-180910305 AATTTTCTAGACATGAAGAAAGG - Intronic
1002879867 6:1241939-1241961 AAATATCTACAAAATAATGAGGG + Intergenic
1003090155 6:3094587-3094609 ATATATATATATATGAAGAAAGG + Intronic
1003330891 6:5127814-5127836 AAATAAATAAAAATGAAAAAAGG - Intronic
1003361557 6:5431237-5431259 AAATATCTACAAGTGTGCAACGG - Intronic
1003389003 6:5696651-5696673 AAATATCTATAAAGATAGAAAGG + Intronic
1003641164 6:7876386-7876408 AATTTTCTACAACTAAAGAAAGG - Intronic
1003680835 6:8253582-8253604 AGATATTTAAAAATGAATAATGG + Intergenic
1004772387 6:18798694-18798716 AAAAAACTAAGAATGAAGAAAGG + Intergenic
1005099355 6:22153469-22153491 CAATATGTAAAAAGGAAGAATGG + Intergenic
1005275869 6:24216858-24216880 AAATATCTGCATAGCAAGAATGG - Intronic
1005518762 6:26579720-26579742 AAATAACAAGCAATGAAGAATGG - Intergenic
1005656159 6:27939833-27939855 AAATTTCTGCAAATGAATAAGGG + Intergenic
1007394116 6:41567656-41567678 AAATTTCTGAAAATGAAGAACGG + Intronic
1008024903 6:46624291-46624313 ACATGTCTACAAATGGAAAAAGG - Intronic
1009616675 6:66017352-66017374 AAATATCTAAAAATAAAAACTGG + Intergenic
1009659237 6:66589082-66589104 AAATATCTGTAAATAAAAAAAGG + Intergenic
1010021053 6:71160345-71160367 AAAAATTAACAAAAGAAGAATGG - Intergenic
1010261994 6:73827950-73827972 AAAGATCTACAAATGGAACATGG - Exonic
1010363927 6:75027924-75027946 AAATATCTAAGAAAGCAGAATGG - Intergenic
1010425430 6:75723882-75723904 AAATATATACAGCTGAAAAATGG + Intergenic
1010518640 6:76805410-76805432 AAAATTTTAAAAATGAAGAAAGG - Intergenic
1010689569 6:78893175-78893197 TATTATCTACAAAGGAACAAAGG + Intronic
1011015770 6:82752946-82752968 AAATTTCCACAACTGAAGACAGG + Intergenic
1011510266 6:88093137-88093159 AAATGTCTCTAAATGAAAAAAGG + Intergenic
1011655728 6:89550285-89550307 AAATCTCTTCAACAGAAGAATGG + Intronic
1011898543 6:92262503-92262525 ATATATCTAAAAGTGAAGAATGG - Intergenic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1012454214 6:99386591-99386613 CAATATCAAGAAATAAAGAAAGG + Intronic
1012645487 6:101673762-101673784 AAGTAACTACAAATGAAGACTGG - Intronic
1012769582 6:103413988-103414010 AAATATCTTCCAATGAACATAGG - Intergenic
1013445785 6:110224953-110224975 AAAGAGCTGCAAATGAAAAAAGG - Intronic
1013623418 6:111913038-111913060 AAAGTTCTAGAAATGAATAATGG - Intergenic
1013626853 6:111946694-111946716 AAATGTCCACCAATGATGAATGG + Intergenic
1013801253 6:113947287-113947309 AAATTTGTAAAAATGAAGAATGG + Intronic
1014174589 6:118317798-118317820 AAATATTTCCAAATTAGGAAGGG + Intergenic
1014430840 6:121368722-121368744 AAATATCTAGAAATTAACCAGGG + Intergenic
1014489091 6:122039651-122039673 AAAAATCTATAAATTAATAAAGG + Intergenic
1015138551 6:129902629-129902651 AAGTATCTAAAAATGAAGAGTGG - Intergenic
1015291871 6:131546693-131546715 AAGTTATTACAAATGAAGAAAGG - Intergenic
1015465654 6:133545418-133545440 AAATGTCTCCAAAGAAAGAAAGG - Intergenic
1015486972 6:133783008-133783030 AAATAACTACAAATGAAACGTGG - Intergenic
1015627318 6:135193159-135193181 AAATATCTAGAAATAAGGAAGGG - Intronic
1015749607 6:136547082-136547104 AAATATCTGCAATTAAATAAGGG - Intronic
1016419003 6:143865189-143865211 AAAAATCTATAAATGATGATTGG + Intronic
1017267132 6:152460546-152460568 AAATATTTTAAAATGAAGAATGG - Intronic
1017330895 6:153197400-153197422 ACAGATCTGCACATGAAGAATGG + Intergenic
1017642633 6:156509279-156509301 AAACATTAAAAAATGAAGAAAGG - Intergenic
1017715108 6:157204768-157204790 AAATATTTAGAAATAAAAAATGG + Intronic
1017875900 6:158524098-158524120 AAAAATCAACAAAGGAAGGAAGG + Intergenic
1018364871 6:163109518-163109540 AAATATTTCAAAAGGAAGAAAGG - Intronic
1018444815 6:163846105-163846127 AAATGTCTACAAACTAAGAATGG - Intergenic
1018540144 6:164870792-164870814 AAATATAGGCAAATGATGAAGGG + Intergenic
1018959018 6:168433275-168433297 AAAATTCTAAAAATGAATAAAGG + Intergenic
1019058510 6:169239690-169239712 AAATTTCTACAAGTGAAGAAAGG + Exonic
1019546115 7:1577414-1577436 AAATGTCTTCAATAGAAGAATGG - Intergenic
1019554551 7:1622377-1622399 AAACAAAAACAAATGAAGAAAGG + Intergenic
1019654425 7:2182558-2182580 AAATGTCTACAGCTGATGAATGG + Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1021385826 7:20028500-20028522 AGGTATCTACAAATGTAAAAAGG + Intergenic
1021502823 7:21348892-21348914 ACATATAAACAAATTAAGAAGGG + Intergenic
1022608068 7:31835801-31835823 AACTATCTAGTAATGAAGTAGGG - Intronic
1022623832 7:32013625-32013647 AAACATCTCCAAATAAGGAAAGG + Intronic
1022767794 7:33434066-33434088 AAATATTTGAAAATTAAGAATGG - Intronic
1022851931 7:34272568-34272590 AAATATCTTCCTGTGAAGAAAGG - Intergenic
1023350128 7:39312197-39312219 AAACACCTGGAAATGAAGAAAGG + Intronic
1023950843 7:44843473-44843495 GTATATTTACAAATGAGGAAGGG - Intronic
1025314202 7:57997923-57997945 AAATATCTTCACATGAATACTGG + Intergenic
1025336453 7:58406181-58406203 AAATATCTTCAAATAAAAACTGG + Intergenic
1025354444 7:58725048-58725070 AAATATCTTCAAATAAAAACTGG + Intergenic
1025356639 7:58763640-58763662 AAATATCTTCAAATAAAAACTGG + Intergenic
1025363448 7:58884593-58884615 AAATATCTTCAAATAAAAACTGG + Intergenic
1025430823 7:60080190-60080212 AAATATCTTCAAATAAAAACTGG + Intergenic
1025430995 7:60083257-60083279 AAATATCTTCAAATAAAAACTGG + Intergenic
1025452972 7:60473701-60473723 AAATATCTTCAAATAAAAACTGG + Intergenic
1025501316 7:61303142-61303164 AAATATCTTCAAATAAAAACTGG - Intergenic
1025516176 7:61649365-61649387 AAATATCTTCAAATAAAAACTGG - Intergenic
1025522810 7:61761072-61761094 AAATATCTTCAAATAAAAACCGG - Intergenic
1025540513 7:62078191-62078213 AAATATCTTCAAATAAAAACTGG - Intergenic
1025546563 7:62180099-62180121 AAATATCTTCAAATAAAAACCGG - Intergenic
1025571837 7:62583029-62583051 AAATATCTTCACATGAAAACTGG - Intergenic
1025577275 7:62663321-62663343 AAATATCTTCAGATGAAAACTGG - Intergenic
1025596399 7:62932630-62932652 AAATATCTTCAAATAAAAACTGG - Intergenic
1025866616 7:65388340-65388362 AAAGATCTACAAATGTAGGCTGG + Intronic
1026442795 7:70458650-70458672 AAACATCAACAAAGGGAGAAGGG - Intronic
1026650816 7:72214513-72214535 AAATATCTGCATATTAAGATAGG + Intronic
1027521161 7:79210176-79210198 AAATGTCTACAAAGAAAAAATGG + Intronic
1027525364 7:79262146-79262168 AAATATTTAGAGATAAAGAAAGG - Intronic
1027550615 7:79589353-79589375 CAATATCTACAAGTGAATCAAGG - Intergenic
1027714430 7:81652436-81652458 AAATAGTTAAAACTGAAGAAAGG + Intergenic
1027715981 7:81670306-81670328 AAATAAATCCAAATGAAAAATGG - Intergenic
1027716569 7:81679047-81679069 AATTATCTACAATTTACGAATGG + Intergenic
1027753786 7:82185431-82185453 AAATATCAACAATGGAACAAAGG + Intronic
1027863765 7:83620188-83620210 AAAAAAATACAAATGATGAAAGG + Intronic
1028070840 7:86448188-86448210 AAATACATACAAATCAGGAATGG - Intergenic
1028260273 7:88655834-88655856 CTATATTTACAAATGAAAAAAGG - Intergenic
1028442124 7:90875678-90875700 AAATATCTAAAAATAGAGAAAGG - Intronic
1029014152 7:97296927-97296949 AAAAGTCTAGGAATGAAGAAAGG - Intergenic
1029498427 7:100911562-100911584 TAATAGCTAAAAATTAAGAAGGG - Intergenic
1030016165 7:105224153-105224175 AAATATTTAAAAATATAGAATGG - Intronic
1030112707 7:106040218-106040240 AAATATCATCAACTGATGAATGG - Intergenic
1030463486 7:109870683-109870705 AAATAACTACAAACCAAGGAAGG - Intergenic
1030777312 7:113550640-113550662 AAATCTTGACAAAGGAAGAATGG - Intergenic
1031223287 7:119000874-119000896 AAGTATCTACATATGAGGACAGG - Intergenic
1031240579 7:119233300-119233322 AAATTAATACATATGAAGAAAGG + Intergenic
1031256650 7:119459965-119459987 AAATAGCTACAAATGTAGTAGGG + Intergenic
1031364209 7:120884565-120884587 AAAAAACTGCAAATGAGGAAAGG - Intergenic
1031562920 7:123260207-123260229 ACAGATCAACAAATGAACAAGGG - Intergenic
1031737186 7:125381339-125381361 ATATATGTTCAAATGAAGATCGG - Intergenic
1031937084 7:127746624-127746646 AAATATCTCCCAATGAAATAAGG - Intronic
1032559413 7:132873101-132873123 AAATAAATAAAAATGAAGAGGGG + Intronic
1032568374 7:132972066-132972088 AAATATATACATATGGGGAAGGG + Intronic
1032860108 7:135868719-135868741 AAATAACTAAGAATGAGGAAAGG - Intergenic
1033890361 7:146005470-146005492 AAACATTTAAAAAAGAAGAATGG + Intergenic
1033984165 7:147202465-147202487 AAACATTTATAGATGAAGAAAGG + Intronic
1034295041 7:149964670-149964692 AAATATATATAAATCAAGAGAGG - Intergenic
1034811020 7:154132276-154132298 AAATATATACAAATCAAGAGAGG + Intronic
1036991339 8:13599574-13599596 AAATATCTAGAAATAAACTACGG + Intergenic
1037106309 8:15112273-15112295 AAATAGCAACAAATCATGAAGGG - Intronic
1037241395 8:16782850-16782872 AATTATCTAAGGATGAAGAAGGG - Intergenic
1037452243 8:19026889-19026911 ATATATATACAAAGAAAGAAAGG + Intronic
1037874129 8:22530529-22530551 AAATAAATAAAAAGGAAGAATGG + Intronic
1038664504 8:29526421-29526443 AAAGATGTTGAAATGAAGAAAGG + Intergenic
1039108920 8:34020444-34020466 AAATATACACCAATAAAGAATGG - Intergenic
1039175920 8:34805639-34805661 AAATAACTACTAATGCACAAGGG - Intergenic
1039210724 8:35210832-35210854 AAACATCCTAAAATGAAGAATGG + Intergenic
1039311873 8:36325154-36325176 AAATAATTAGTAATGAAGAAAGG - Intergenic
1039364472 8:36915914-36915936 AAATATTTAAAAAGGAAGAAAGG + Intronic
1041466062 8:58158841-58158863 AAATATATACATATGTAGTATGG + Intronic
1041528830 8:58839310-58839332 AAATAGCTACATATGACTAATGG + Intronic
1042577371 8:70235336-70235358 AAAGTTCTAGAAATGAATAATGG + Intronic
1042634848 8:70862727-70862749 AAATATCTTTACATGAAGGATGG - Intergenic
1042698956 8:71590255-71590277 AAATATATCCTACTGAAGAAAGG - Intronic
1044049961 8:87488722-87488744 AAATATCTTCAAATACAAAATGG + Intronic
1044144392 8:88693348-88693370 AAATATCTAGGAATGAACCAAGG - Intergenic
1044484750 8:92738751-92738773 AACTTTCTACAAATTGAGAAAGG + Intergenic
1044500008 8:92943029-92943051 AACTATCTAAAAATGAAATAAGG + Intronic
1045941193 8:107740071-107740093 ATCTATCTACAAAGGGAGAATGG + Intergenic
1046192661 8:110818644-110818666 AAATATCTCCAAATGGTAAAAGG + Intergenic
1046194436 8:110840696-110840718 AAATATCAAAAATTGAAGATTGG - Intergenic
1046288040 8:112120877-112120899 AAATATTAATATATGAAGAAGGG - Intergenic
1047640146 8:126810381-126810403 AAATATCTAAGAATTAACAACGG + Intergenic
1047904964 8:129463104-129463126 AAAGACATACAGATGAAGAAAGG + Intergenic
1048171086 8:132107103-132107125 AAATAGATACAGAAGAAGAAGGG - Intronic
1050491028 9:6187994-6188016 AGATATTTAAAAATGAAAAATGG + Intergenic
1050911652 9:11079042-11079064 AACTATATGTAAATGAAGAAAGG - Intergenic
1050966139 9:11805602-11805624 AAATATCTACATATAAAAAAAGG - Intergenic
1051288245 9:15518416-15518438 AAATCTATACAAATGAAGACTGG - Intergenic
1051478670 9:17536326-17536348 AAATATCCATCAATGACGAATGG - Intergenic
1051857898 9:21590144-21590166 GCATATCTAAAAATGAAGATAGG - Intergenic
1052136749 9:24921153-24921175 AAAGATTTACACATGAGGAAGGG - Intergenic
1052477371 9:28977258-28977280 TATTATATACAAATGGAGAACGG + Intergenic
1052554505 9:29997088-29997110 AAATATCTATAAATGCCAAAGGG + Intergenic
1052678235 9:31654702-31654724 AAACATTTACAAAGGGAGAAAGG + Intergenic
1053950378 9:43368812-43368834 AAATATCTTCAAATAAAAACTGG + Intergenic
1053950688 9:43374960-43374982 AAATATCTTCAAATAAAAACTGG + Intergenic
1053951460 9:43392672-43392694 AAATATCTTCAAATAAAAACTGG + Intergenic
1054051046 9:45111220-45111242 AAATATCTTCAAATAAAAACTGG + Intergenic
1054063531 9:45324477-45324499 AAATATCTTCAAATAAAAACTGG + Intergenic
1054063720 9:45327706-45327728 AAATATCTTCAAATAAAAACTGG + Intergenic
1054065661 9:45361376-45361398 AAATATCTTCAAATAAAAACTGG + Intergenic
1055145434 9:72928369-72928391 AAATATCTTCAAAGCAAGATGGG - Intronic
1055302413 9:74896113-74896135 AAAAATTTACATATGTAGAATGG + Intergenic
1055706335 9:79008896-79008918 ATAAATGTACAAAAGAAGAAAGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055835611 9:80437545-80437567 AAAAATCAACAAATGATAAAAGG + Intergenic
1055857587 9:80709194-80709216 TGATATATTCAAATGAAGAATGG - Intergenic
1056503903 9:87238341-87238363 GAATATCTACAGAGAAAGAATGG - Intergenic
1056504866 9:87248750-87248772 TAATATGTACATATGAAGAAGGG - Intergenic
1057549711 9:96043355-96043377 AAATTTCTAGAGATGAAAAATGG + Intergenic
1058005944 9:99914372-99914394 AAGTTTCTACAACTGAAGTAGGG + Intronic
1058378128 9:104348916-104348938 AAATATCTATAAGTGAGGTATGG - Intergenic
1058513401 9:105744201-105744223 AAATATAAACAATAGAAGAATGG + Intronic
1058591661 9:106571809-106571831 AAATAACTGAAAATGATGAATGG - Intergenic
1058602879 9:106690203-106690225 ACATATCTACATATTAACAATGG + Intergenic
1058891562 9:109365720-109365742 AAATACAAACAAATAAAGAATGG - Intergenic
1058977809 9:110140947-110140969 AAGTTTCAACAAATGAATAATGG + Intronic
1059649664 9:116303944-116303966 AAATAAATGCAAATGAATAAAGG - Intronic
1059732714 9:117072991-117073013 AGATATCTACAAAAGAGAAAAGG + Intronic
1060609145 9:124945602-124945624 AAATATTTTAAAATTAAGAATGG + Intronic
1061047329 9:128173618-128173640 AAAACACAACAAATGAAGAAAGG + Intronic
1061459768 9:130727881-130727903 AAATAAAAACAAATTAAGAATGG + Intronic
1062037158 9:134387487-134387509 AAATATTTACAAATTGCGAAAGG - Intronic
1203379488 Un_KI270435v1:18236-18258 AAATATCTTCACATGAATACTGG + Intergenic
1203382505 Un_KI270435v1:70082-70104 AAATATCTTCACATAAAAAATGG + Intergenic
1203353266 Un_KI270442v1:101817-101839 AAATATCTTCACATGAAAACTGG + Intergenic
1203359991 Un_KI270442v1:210994-211016 AAATATCTTCAAATAAAAAGTGG - Intergenic
1203402118 Un_KI270519v1:117515-117537 AAATATCTTCACATAAAAAATGG + Intergenic
1203593619 Un_KI270747v1:98040-98062 AAATATCTTCAAATAAAAACTGG + Intergenic
1203593787 Un_KI270747v1:100925-100947 AAATATCTTCAAATAAAAACTGG + Intergenic
1203620578 Un_KI270749v1:124584-124606 ATATATCTACACATAGAGAAGGG + Intergenic
1186367678 X:8912487-8912509 AAATATTTTCAATTGAGGAATGG - Intergenic
1186973653 X:14876036-14876058 AAATATATACATAAGAAGATTGG + Intronic
1187402240 X:18971409-18971431 AAATTACTATAAATGATGAAGGG + Intronic
1187672591 X:21683445-21683467 AAATATTTACAAATGAAGTGAGG + Intergenic
1187819860 X:23275907-23275929 ACATATATAGAAATCAAGAAGGG + Intergenic
1188240423 X:27781076-27781098 ACTTTTCTAAAAATGAAGAATGG - Intergenic
1188344076 X:29042684-29042706 TAATATATACAAATCTAGAAAGG - Intronic
1188453227 X:30331779-30331801 AAATATCTACAAGGATAGAAGGG + Intergenic
1188505160 X:30874533-30874555 AAGTACCTACAAATAAACAAGGG + Intronic
1188527605 X:31103176-31103198 AGTAATCTACAAAAGAAGAAAGG + Intronic
1188755935 X:33963644-33963666 AAATATCTACTATTCTAGAAAGG + Intergenic
1188935129 X:36166536-36166558 AAATATCTTCAAAGAAATAAAGG - Intergenic
1189029020 X:37430427-37430449 ACATCTCTACAAAAGTAGAATGG - Intronic
1189074290 X:37899849-37899871 AACTATCTACCAATGAAGAAAGG + Intronic
1189081924 X:37982134-37982156 AAATATCTTCAAAGGACTAATGG + Intronic
1189425427 X:40896165-40896187 AAATAAATACAAATAAAGGAAGG - Intergenic
1190496902 X:51035074-51035096 ATATATCTACAAATAAACATAGG - Intergenic
1191260039 X:58308082-58308104 AAATATCCACAAATAAAAACAGG + Intergenic
1192564671 X:72153792-72153814 AAATCTCATCAAAAGAAGAAAGG + Intergenic
1193562479 X:83036140-83036162 ACATATCTCCCAATAAAGAAAGG + Intergenic
1194610755 X:96040675-96040697 AAATATATACAAAGAAAGCAAGG - Intergenic
1195597486 X:106709254-106709276 CAATATCCACAAATGAGCAATGG - Intronic
1196001301 X:110789498-110789520 CAATATCTACAAATATAGACTGG + Intronic
1196358888 X:114829392-114829414 AAATATTTGCAAATAAAAAATGG - Intronic
1197416992 X:126187523-126187545 CAATATATGCAAATCAAGAAAGG - Intergenic
1197577334 X:128231324-128231346 AAAGATATACAAATAAATAAAGG + Intergenic
1198424243 X:136498668-136498690 ATATATATACAAATACAGAATGG - Intronic
1198445285 X:136707487-136707509 ATTTTTCTACAAATGAAGACAGG - Intronic
1198476865 X:137003154-137003176 AAATATATAAAAATAAACAATGG + Intergenic
1198840679 X:140854091-140854113 AAATATCTACTAGGGAAGAAAGG + Intergenic
1199023145 X:142905999-142906021 AAATATTTATAAGTGAAGACAGG - Intergenic
1199119477 X:144034526-144034548 AATTATCAACAGATGAAGACTGG + Intergenic
1199472930 X:148214795-148214817 CAAAATCTACAAATGCAGCAGGG + Intergenic
1200237689 X:154476522-154476544 AAATATTAAGAAAGGAAGAAAGG + Intergenic
1202202739 Y:22371242-22371264 AAATATAAATAAATGAAAAAAGG + Intronic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic