ID: 916919602

View in Genome Browser
Species Human (GRCh38)
Location 1:169450098-169450120
Sequence AAGTCACAGCCCAGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 11, 2: 39, 3: 114, 4: 457}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916919602_916919610 28 Left 916919602 1:169450098-169450120 CCTGTGTCCCTGGGCTGTGACTT 0: 1
1: 11
2: 39
3: 114
4: 457
Right 916919610 1:169450149-169450171 ATCCCAGTAGGTGAAACAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 147
916919602_916919606 16 Left 916919602 1:169450098-169450120 CCTGTGTCCCTGGGCTGTGACTT 0: 1
1: 11
2: 39
3: 114
4: 457
Right 916919606 1:169450137-169450159 GGTTCTCCCTCCATCCCAGTAGG 0: 1
1: 0
2: 2
3: 13
4: 184
916919602_916919611 29 Left 916919602 1:169450098-169450120 CCTGTGTCCCTGGGCTGTGACTT 0: 1
1: 11
2: 39
3: 114
4: 457
Right 916919611 1:169450150-169450172 TCCCAGTAGGTGAAACAGAAGGG 0: 1
1: 0
2: 0
3: 25
4: 218
916919602_916919605 -5 Left 916919602 1:169450098-169450120 CCTGTGTCCCTGGGCTGTGACTT 0: 1
1: 11
2: 39
3: 114
4: 457
Right 916919605 1:169450116-169450138 GACTTTTACAAGTGTTTCTTAGG 0: 1
1: 0
2: 2
3: 31
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916919602 Original CRISPR AAGTCACAGCCCAGGGACAC AGG (reversed) Intronic
900295357 1:1946545-1946567 AAGTGGCCACCCAGGGACACGGG - Intronic
900654922 1:3751962-3751984 AAGTCAGCTCCCAAGGACACAGG - Intergenic
900723236 1:4194306-4194328 AGTTCATAGCCCAGGGTCACAGG - Intergenic
901730257 1:11273721-11273743 AGGGCACTGCCCAGGGCCACCGG - Exonic
901882840 1:12204160-12204182 AAGACAGAGGCCAGGGACACGGG - Intronic
902372680 1:16015976-16015998 AAGGAACAGGCCAGGGACATGGG + Intronic
902543110 1:17168205-17168227 TAGTCAGCGTCCAGGGACACTGG - Intergenic
904629741 1:31831898-31831920 AACTCACTGCCTAGGGTCACCGG - Intergenic
904854356 1:33485910-33485932 AGGTCAGAGTCCAGGGACACAGG - Intronic
905488053 1:38320835-38320857 TGGTCACAGTTCAGGGACACAGG - Intergenic
905822771 1:41006669-41006691 AATTCCCAGCCCAGGGTGACAGG + Intronic
905829895 1:41057139-41057161 AGTTCACAGCCCAGGGGCAAAGG + Intronic
906017661 1:42596552-42596574 AATTTACAGTCCAGGGGCACAGG + Intronic
906429697 1:45745569-45745591 AAGTCACAGGCCAGGCGCAGTGG + Intronic
906453137 1:45969924-45969946 AGTTCACAGTCCAGGGACAAAGG - Intronic
906763743 1:48407239-48407261 AAGTGAAAGCCAAGGGAGACTGG - Intronic
908523244 1:64965503-64965525 AAGTCACTCCCCAGGGTCCCTGG - Intronic
908702705 1:66919853-66919875 AAGTCTCATCCCAGGGACAAGGG + Intronic
909597664 1:77424006-77424028 AGTTCACAGTCCAGGGCCACAGG + Intronic
910410085 1:86934044-86934066 AGGTCACAGTCCAAAGACACAGG - Intronic
910806910 1:91197586-91197608 CAGTCACACCCCAGAGAGACTGG + Intergenic
911310063 1:96281381-96281403 TAGTCACAGACCAGGGACTCGGG - Intergenic
912478992 1:109963372-109963394 AGTTTACAGCCCAGGGGCACAGG + Intergenic
914203545 1:145506797-145506819 AGGTCACAGCCCAGGGGCACAGG - Intergenic
914482667 1:148079951-148079973 AGGTCACAGCCCAGGGGCACAGG - Intergenic
914487208 1:148121328-148121350 AAGTCTCTGACCAGGGACGCTGG - Intronic
915288014 1:154865069-154865091 AAGTCACAGCCTGGGGAAAGGGG + Intronic
915728502 1:158036062-158036084 CAGTCAAAACCCAGGGATACTGG + Intronic
915844493 1:159249523-159249545 AGGTCACATTCCAGGAACACAGG + Intergenic
915871565 1:159565173-159565195 AGGTCACAGCCCAAGGACTCTGG + Intergenic
916650990 1:166834242-166834264 AGGTCCCAGCCCAGGGACACAGG + Intergenic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
917734021 1:177904134-177904156 AAGTCACAGATCAGGCCCACAGG + Intergenic
918344126 1:183591264-183591286 AAATCAAGGCCCAGTGACACAGG - Intronic
918771872 1:188571476-188571498 AGCTCACAACCCAGGGACACAGG + Intergenic
919117483 1:193298536-193298558 AGGTCACAGGCCAGGGACTAGGG - Intergenic
920062987 1:203240880-203240902 AAGTCATGGCCCAGGGACTCAGG + Intronic
920246714 1:204593344-204593366 GATTCACAGTCCAGGGACAAAGG + Intergenic
920795712 1:209134198-209134220 AGGGCACAGCCCAGGGGCACAGG + Intergenic
921605292 1:217144992-217145014 AGCTCATAGCCCAGAGACACAGG + Intergenic
922079691 1:222283805-222283827 AAGTCATAAGCCAGGGACACAGG + Intergenic
922795382 1:228337149-228337171 CAGACACACCCCAGGGACCCTGG - Intronic
922813662 1:228433595-228433617 AGGTCACAGTCCAGGGGCACAGG - Intergenic
923351871 1:233115220-233115242 AGGTTACAGCCCGGAGACACAGG + Intronic
923533110 1:234827338-234827360 GAGAATCAGCCCAGGGACACTGG - Intergenic
924004835 1:239598055-239598077 AAAACACAGCCCAGGGCCAGGGG + Intronic
924166040 1:241284493-241284515 AAGTAACACCCCAGGAACAATGG + Intronic
924541151 1:244981936-244981958 AGGTCACAGCCCATTGACACAGG + Intronic
924690561 1:246345939-246345961 ATGCCACAGTCCAGGGACAAAGG + Intronic
1063235848 10:4115613-4115635 AGATCACAGCCCAGGGACATAGG - Intergenic
1063433043 10:6007793-6007815 AGGTCACAGCCCAGGGGTACAGG - Intergenic
1063484162 10:6403483-6403505 AACTCACGGTTCAGGGACACTGG - Intergenic
1063606470 10:7527032-7527054 AAGTCACAGCACATGGGGACAGG - Intergenic
1063757696 10:9033216-9033238 AGTTCACAGTCCAGGGACATGGG + Intergenic
1063832626 10:9972269-9972291 GTGTCATAGCCCAGTGACACAGG + Intergenic
1063873751 10:10449335-10449357 AAGTTACAGCCCTGTGCCACTGG - Intergenic
1063976054 10:11416471-11416493 AGCTCACAGCCCAGGGGCACAGG + Intergenic
1064524863 10:16244025-16244047 AAGTCACAAGCCAGAGACATTGG + Intergenic
1064581764 10:16799878-16799900 AGGTCACAGCCAAGTGGCACAGG + Intronic
1064703878 10:18050254-18050276 AGGTCACAGCCCAAGGACACGGG + Intergenic
1065084465 10:22160944-22160966 ACATCACAGCCAAGGGGCACAGG + Intergenic
1065639966 10:27771397-27771419 AAGTCGCAGCCCAGGGGCACAGG - Intergenic
1066020154 10:31290533-31290555 AAGTCACAGTCCAGAGACTAAGG + Intergenic
1066162493 10:32748656-32748678 AGTTCATAGTCCAGGGACACAGG - Intronic
1066268144 10:33796359-33796381 AAATCACAGACCAAGGACAAAGG - Intergenic
1066377686 10:34872332-34872354 AGTTCACAGTCCAGGGGCACAGG + Intergenic
1066626077 10:37407023-37407045 AACCCACAGACCAGGGGCACAGG + Intergenic
1067197593 10:44135623-44135645 AGGCCACAGGCCAGGGACACAGG + Intergenic
1067660636 10:48234175-48234197 AAGTCACAGAGCAGGGTCCCAGG + Intronic
1068447852 10:57146444-57146466 AACTCAGAGCCCATGGACATGGG + Intergenic
1069115411 10:64499209-64499231 AAGTCATAACCCAGGGACTCAGG - Intergenic
1070666190 10:78345828-78345850 AAGTCAGAGGCCAGGCACAGTGG - Intergenic
1071080784 10:81807378-81807400 AGTTCACAGTCCAGAGACACAGG + Intergenic
1072830668 10:98655092-98655114 AGATCATAGCCCAGGGACACAGG - Intronic
1073248532 10:102107902-102107924 CAGGCCCAGCCCAGGGCCACTGG + Exonic
1073318481 10:102599554-102599576 TTGTTCCAGCCCAGGGACACTGG - Intronic
1074430187 10:113387635-113387657 ATTTCCCAGCCCTGGGACACAGG + Intergenic
1074528180 10:114279042-114279064 AACACACAGCCCAGGTACCCAGG + Intronic
1074581079 10:114720067-114720089 AAATGAGAGCACAGGGACACAGG - Intergenic
1074799710 10:116987230-116987252 AGGTCACATCCTAGGGACACAGG + Intronic
1074805372 10:117045356-117045378 AGGTCACAGCCCAGAGGCACAGG + Intronic
1074926237 10:118075201-118075223 AGTTCACAGCCCAGGGACCCAGG - Intergenic
1075518809 10:123131770-123131792 AATACACAGCCCTGGGAGACAGG - Intergenic
1075555315 10:123426777-123426799 AACTCACAGCCCAAAGACATAGG - Intergenic
1076099376 10:127763233-127763255 AGATCACAACCCAGGGACACAGG - Intergenic
1076141739 10:128084837-128084859 AAGTCAAAGTCGAGGGGCACCGG + Exonic
1076199629 10:128547613-128547635 AGGTCACAGCCCAGGGGTTCTGG + Intergenic
1076358278 10:129868667-129868689 AGGCCACAGCCCAGGGAGACAGG + Intronic
1076743182 10:132498177-132498199 AAACCACAGCCCTGGGACGCTGG + Intergenic
1077503982 11:2921834-2921856 AAGGCCCACACCAGGGACACCGG - Intronic
1077694723 11:4383843-4383865 AAGCCCCAGCCCTGGGGCACAGG + Intergenic
1077924530 11:6667775-6667797 AGGTCATAGCCCAAGGACATGGG - Intergenic
1079992836 11:27265026-27265048 AACTCACAGGCCAGGCACAGTGG + Intergenic
1081410327 11:42750053-42750075 AAGTCTCAGCCCTGGTGCACTGG - Intergenic
1081434635 11:43013480-43013502 AAGTCACAGCCTATGGGCACAGG + Intergenic
1081757081 11:45552384-45552406 AAGTCAAAGACCTGTGACACAGG - Intergenic
1081993962 11:47352015-47352037 AAATCACAGCCCAGGGACCTGGG - Intronic
1083252013 11:61474655-61474677 AAGTCACAGAGCAGAGAAACTGG + Intronic
1083381347 11:62271235-62271257 GAGTGACAACACAGGGACACTGG - Intronic
1083658217 11:64240507-64240529 GAGTCACAGCCCAGGTGCACAGG + Intergenic
1084679829 11:70660498-70660520 ATGCCAGTGCCCAGGGACACTGG - Intronic
1084971295 11:72773594-72773616 ACGTGACAGCCCCGGGACAGGGG - Intronic
1085417035 11:76326038-76326060 AAGTCACAGCTCTGAGACCCAGG - Intergenic
1085767670 11:79297392-79297414 AAGTCACAAGCCTGGGACAATGG + Intronic
1085980089 11:81714398-81714420 AGGTCACAGCACAAGGATACAGG - Intergenic
1087181610 11:95147736-95147758 AAGACACAGCCCAGGGCCAGAGG - Intergenic
1088666443 11:112098410-112098432 AAGTCGCAGGCCAGGCACAGTGG - Intronic
1088704464 11:112448969-112448991 AAGGCACAGCCCTGGGAAAGGGG - Intergenic
1088786696 11:113188778-113188800 AATTCACTGTCCAGGGAGACAGG + Intronic
1089882570 11:121788773-121788795 ATGTCACAGGCCAGGTACTCTGG - Intergenic
1090014558 11:123074548-123074570 AAGTTCCAGCCTAGGGACAGAGG - Intronic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1090439860 11:126716505-126716527 CAGCCACATCCCAGGGAAACAGG + Intronic
1090578994 11:128139464-128139486 AGGTTACAGCCCAGGGGTACAGG + Intergenic
1091876079 12:3933973-3933995 GGTTCACAGCCCAGGGGCACAGG + Intergenic
1091892318 12:4069326-4069348 AGTTCACAGCCCAGAGGCACAGG - Intergenic
1091926770 12:4357719-4357741 AAGTGACAGGGCAGGGACACTGG + Intergenic
1091935949 12:4434623-4434645 AAACCAAGGCCCAGGGACACAGG + Intronic
1092393320 12:8101398-8101420 AAGTAACAGGCCAGGCACAGTGG + Intergenic
1093096014 12:14973190-14973212 CAGCCACAGCCCAGGCCCACAGG - Intronic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1093425232 12:19021376-19021398 AAGTCAATGCCCTGAGACACCGG + Intergenic
1093523551 12:20077963-20077985 AAGACAAAGCCCAGGGCCTCAGG + Intergenic
1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG + Exonic
1096478906 12:51924933-51924955 CAGTCCCAGCCCTGGGAGACTGG - Intergenic
1096793246 12:54058219-54058241 AGGACACAGCCCAGGTTCACGGG + Intergenic
1097459151 12:59838820-59838842 AGATCACAGCCCAGGAACACAGG - Intergenic
1097949266 12:65408665-65408687 AAGTCACAGCCCAAGGGCGCAGG - Intronic
1098838663 12:75452674-75452696 ACTTTACAGTCCAGGGACACTGG - Intergenic
1099907121 12:88784662-88784684 AGTTCGCAGCCCAGAGACACAGG + Intergenic
1101910825 12:108858970-108858992 AGGTCACAGCCCCAGGACAGAGG - Intronic
1102021178 12:109684069-109684091 AAGTCAGAGGCCAGGCACAGTGG - Intergenic
1103094400 12:118121223-118121245 AGGTCACAGCTCATGGACAAAGG + Intronic
1103917516 12:124383775-124383797 AATTCACTGCCCAAGGTCACAGG + Intronic
1103942122 12:124506839-124506861 CCGTCACAGCCCAGGGGCACGGG - Intronic
1103958352 12:124592245-124592267 AAGTCCCAGCCCAAGGACTTTGG + Intergenic
1104327550 12:127813458-127813480 ATGTTACAGCCTGGGGACACGGG + Intergenic
1104352469 12:128056742-128056764 AATTCACAGCCCTGTGACGCTGG + Intergenic
1104534925 12:129609836-129609858 AAGACACAGACCAGGGCCTCAGG + Intronic
1104559833 12:129833718-129833740 AATTCACAGCCCATTGCCACAGG + Intronic
1105896374 13:24720060-24720082 AAGTCAGATCCCAAGGACAGGGG - Intergenic
1106237558 13:27876623-27876645 AGGTCACAGCACAGGAACACAGG + Intergenic
1106306454 13:28515399-28515421 AAGGCACAGTTCAGAGACACAGG - Intergenic
1106999429 13:35526561-35526583 AAGTGACACTCCAAGGACACTGG - Intronic
1107980132 13:45727371-45727393 AGGTCACAGCCCAGGGGCACAGG - Intergenic
1109130011 13:58573701-58573723 AGGGCACAGACCAGAGACACAGG - Intergenic
1109186521 13:59275546-59275568 AAGTGACAGCCCAGGGGCACAGG + Intergenic
1109569809 13:64172925-64172947 TAGTTACATCTCAGGGACACAGG + Intergenic
1109605355 13:64687339-64687361 AAGTGACAGCCCAGTGAAAATGG + Intergenic
1110790808 13:79584714-79584736 AGGTCACAGCCCAGGGACACAGG + Intergenic
1110867758 13:80416758-80416780 AGTTTACAGCCCAGGGAGACAGG - Intergenic
1111243912 13:85509618-85509640 ATGCCACAGCCCGGAGACACAGG - Intergenic
1111818134 13:93180761-93180783 AGCTCACAGCCCAGGGACACAGG - Intergenic
1112278667 13:98044043-98044065 AAGTTACAGCCCAGGAGCAGGGG + Intergenic
1112320817 13:98405881-98405903 AAGGCACAGCCCCGGGCAACGGG - Intronic
1113086717 13:106576509-106576531 AGGTCACAGCCCAGGGTCACAGG - Intergenic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1116010703 14:39348118-39348140 AAGGCACAGGCCAGGCACAGTGG - Intronic
1116083826 14:40208679-40208701 AGGTCACAACCCTGGAACACAGG + Intergenic
1116280686 14:42903213-42903235 AGGTCATAGTCTAGGGACACAGG - Intergenic
1117260017 14:54022700-54022722 AATTCACAGTCCAGGGGCAGAGG - Intergenic
1118844317 14:69535315-69535337 GAGTCACAGCCAAAGGAAACTGG + Intergenic
1118889744 14:69898995-69899017 AGTTCACAGCCCAAGGGCACAGG - Intronic
1118977629 14:70691409-70691431 AAGTTACAGGCCAGGTACAGTGG - Intergenic
1119069091 14:71563014-71563036 GAGTTACAGTCCAGGGAAACAGG - Intronic
1121406195 14:93720692-93720714 AACCCGCAGCCCAGGGCCACTGG - Exonic
1122383697 14:101329433-101329455 AAGTCTCAGCTCAGAGTCACGGG + Intergenic
1122708825 14:103640345-103640367 AATTCACAGGCCAGGGGCAGTGG - Intronic
1122742472 14:103880196-103880218 GAGTCAGTGCTCAGGGACACAGG - Intergenic
1122821418 14:104347363-104347385 AGGTAACAGCCTAGGGTCACAGG + Intergenic
1123942792 15:25224667-25224689 AAATCACAGCCTGGGGACCCAGG - Intergenic
1123944359 15:25231844-25231866 AAATCACAGCCTGGGGACCCGGG - Intergenic
1124171819 15:27381103-27381125 AGGTCACAGCCCAGGAACACAGG - Intronic
1124346810 15:28928529-28928551 CAGTCACAGCCCAGGGAAATGGG - Intronic
1124599044 15:31116276-31116298 AAGTCACAGCCCAAGAACACAGG + Intronic
1124718446 15:32090093-32090115 AGGTCAGAGCCCAGACACACAGG - Intronic
1125294804 15:38191146-38191168 AGGTCACAGGCTGGGGACACAGG - Intergenic
1125538800 15:40458161-40458183 AAGGCAGACCCCAGGGACAGGGG - Intronic
1127815714 15:62607106-62607128 AAGTAACATCCAAGGGACCCAGG - Intronic
1127897255 15:63312341-63312363 AACTCTCAGCCCAGGGATTCAGG - Intergenic
1127927485 15:63561009-63561031 GAGTCACAGTGCAGGGAAACTGG + Intronic
1128338916 15:66806247-66806269 GGGTCACAGCCCAGGGGCTCAGG + Intergenic
1128983005 15:72199889-72199911 AACTCACAGCCCAGGCAAACAGG + Intronic
1129564774 15:76609841-76609863 AAGTCACAGTCCAGCTGCACAGG - Intronic
1129722398 15:77884919-77884941 AAGTCATGGACCAGGGACAGAGG - Intergenic
1130055289 15:80518704-80518726 AGGTCACAGCCCCAGGACATAGG - Intronic
1131362884 15:91809641-91809663 GGTTCACAGCCCAGGGGCACAGG + Intergenic
1131409142 15:92191467-92191489 CATTCACAGCCCAGGGACTTTGG + Intergenic
1132282933 15:100635738-100635760 AAGACGCAGCCTAGGGACCCAGG - Intronic
1132590450 16:724125-724147 AAGTCAGTGACCAGGGGCACGGG + Exonic
1132723904 16:1330600-1330622 GGGTCAGAGCCCAGGGACTCTGG - Intergenic
1133124525 16:3637429-3637451 AAGTCACAGGCCAGGGGCACAGG - Intronic
1133130055 16:3671434-3671456 CAGTCACAACCCTGGGGCACAGG + Intronic
1134201018 16:12198949-12198971 AACTCACTCCCCAGGTACACTGG - Intronic
1134394871 16:13853580-13853602 AGTTCAAAGCCCAGAGACACAGG + Intergenic
1135396750 16:22137553-22137575 AAGTCAATGCACAGAGACACTGG + Intronic
1136140672 16:28286385-28286407 AAATCACAGGCCAGGCACAGTGG + Intergenic
1136556000 16:31008257-31008279 TAGTCACAGCTCAGGGAAACTGG - Intronic
1137232287 16:46577757-46577779 AAATCACAGGCCAGGCACAGTGG - Intergenic
1137308910 16:47233744-47233766 AGGTCACAGCCCAGGGACACAGG + Intronic
1138527501 16:57617637-57617659 AGGTCCCAGCCCAGGGCCTCAGG + Intronic
1138551703 16:57752249-57752271 AAGCCACAGACCTGGGACACTGG - Intronic
1138805702 16:60086215-60086237 AAGTCCCAGCACAGGGACCTTGG + Intergenic
1138890041 16:61130735-61130757 CATTCACAATCCAGGGACACTGG - Intergenic
1139128570 16:64112734-64112756 CTGTCACGGCCCAGGGAAACAGG - Intergenic
1140370432 16:74410267-74410289 GAGTCACAGCCAGGGGACACTGG + Intronic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1141078753 16:81032610-81032632 AAGCCACAGTCAAGGGACCCAGG + Exonic
1141134996 16:81459339-81459361 GGGTCACAGCACAGGGCCACGGG - Intronic
1141551483 16:84809483-84809505 AAGACACAGGCCAGGCACAGTGG + Intergenic
1141741003 16:85892955-85892977 AAGTCACAGCCCATGAAACCTGG + Intergenic
1143042870 17:4052234-4052256 AAGTGACTGCTCAGGGATACAGG + Intronic
1143108175 17:4539724-4539746 AGGTCCCAGCCCAGGCAAACGGG - Exonic
1143783952 17:9243281-9243303 GGGTCACAGCCCAGGGAGGCTGG + Exonic
1143878404 17:10011160-10011182 GAGTCTCTGCCTAGGGACACAGG + Intronic
1144129429 17:12231716-12231738 AGGTCACAGCCTAAGGACAAAGG + Intergenic
1144771167 17:17760446-17760468 AGTTCCCAGGCCAGGGACACTGG - Intronic
1145888038 17:28396359-28396381 TTGTCTCAGCCCAGGGAGACTGG - Exonic
1146302268 17:31698565-31698587 AGATCACAGCCCAAGGGCACAGG + Intergenic
1146553756 17:33805218-33805240 AAATCACAGTCCAGAAACACAGG - Intronic
1147591480 17:41686573-41686595 AAGTATCAGGCCAGGCACACTGG + Intergenic
1148127667 17:45245249-45245271 AGGACACTGTCCAGGGACACTGG - Exonic
1148152253 17:45403787-45403809 AAGTCAGAGCTTAGGAACACAGG + Intronic
1148906754 17:50917264-50917286 AAATCACAGCACAGGGGCACAGG - Intergenic
1149508519 17:57216622-57216644 AATTCACAGTCCAGGGGCAAAGG + Intergenic
1149663063 17:58345979-58346001 AAGGCACAGACCTGGGCCACGGG + Exonic
1150481567 17:65515449-65515471 ATTTCCAAGCCCAGGGACACGGG - Intergenic
1150721043 17:67614722-67614744 ACATCACAGCCCAGGCACAATGG + Intronic
1152546680 17:81003923-81003945 AAGGCGCAGCTCAGGGTCACCGG - Intronic
1155855922 18:30834136-30834158 AATTCACAGTCCAGGGGCACAGG + Intergenic
1156094799 18:33516450-33516472 AGGTCACAGCTCAGGGATGCAGG + Intergenic
1156114838 18:33775353-33775375 AAGTTATAGTCCAGGGACTCAGG - Intergenic
1156240516 18:35249362-35249384 ATGTCACAGGCCAGGCACAGTGG + Exonic
1156472243 18:37384548-37384570 TAGACACAGGCCTGGGACACTGG + Intronic
1156619792 18:38835928-38835950 AGGTCACAGCCAAGGGACAGAGG + Intergenic
1156716791 18:40021916-40021938 AGTTCACAGCCCAGGGGTACAGG + Intergenic
1157622921 18:49026562-49026584 CAGTGACAGCCCAGGCACACAGG + Intergenic
1157966800 18:52217645-52217667 ATGTCTGAGCCCTGGGACACTGG - Intergenic
1159865738 18:73702743-73702765 CTGTAACAGCCCAGAGACACTGG - Intergenic
1159962975 18:74569754-74569776 AAGTCAGAGCGCAGGCACACAGG + Intronic
1160885555 19:1345540-1345562 AAGTCATAGGCCGGGCACACTGG - Intergenic
1162178131 19:8846995-8847017 GGGCCAGAGCCCAGGGACACTGG - Intergenic
1162581830 19:11536084-11536106 AAGTCACGGCCCAGGCACGACGG - Intergenic
1163190924 19:15675988-15676010 AAGCCAGAAACCAGGGACACTGG + Intronic
1163222246 19:15929957-15929979 AAGCCAGAAACCAGGGACACTGG - Intronic
1163349865 19:16769651-16769673 GAGTCCCAGCCCAGGGCCCCCGG - Intronic
1165395511 19:35561553-35561575 AAGTCATGGCCATGGGACACAGG - Intronic
1166581900 19:43908391-43908413 AGATCACAGGCCAGGGACTCAGG + Intergenic
1168218274 19:54942361-54942383 AAATCACAGCCCATGGACGTTGG - Intronic
1168271288 19:55251152-55251174 AACGCACAGCTCAGGGAGACAGG - Intronic
1168314686 19:55479511-55479533 AAGGCACAGTCCACGGGCACTGG + Intronic
925392516 2:3506153-3506175 AGTTCACAGCCCAGAGGCACAGG + Intronic
925453768 2:3995877-3995899 AACACATAGCCCAGAGACACAGG - Intergenic
925519789 2:4730694-4730716 AGTTCACAGCCCAGGGACATGGG + Intergenic
925521105 2:4746832-4746854 AAGTCACAGTGCTGGGATACTGG + Intergenic
925543797 2:4995833-4995855 AGGTCACAGTCCAAGGACTCAGG + Intergenic
926916412 2:17896338-17896360 AAGTCACAGGCCAGGCACAGTGG - Intronic
927038205 2:19202814-19202836 AGGGCACAGGACAGGGACACTGG - Intergenic
927693457 2:25224239-25224261 AAGTCACATCCAAGGGGGACGGG - Intergenic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
928259364 2:29752962-29752984 CAGACCCAGCCCAGGGTCACAGG + Intronic
928308778 2:30193175-30193197 AAGTCACAGCCCAGTGAAGAGGG - Intergenic
928502257 2:31908911-31908933 AAGTCACAGACCAGTGGCACAGG + Intronic
928516277 2:32047765-32047787 AAGTCAGAGGCCAGGAACAGTGG + Intergenic
930053149 2:47232316-47232338 AAGTCATATCCCAGTGACTCAGG - Intergenic
930443065 2:51432826-51432848 AGGTCACAGCATAGGGACTCTGG + Intergenic
931598583 2:63978097-63978119 AGGTCGCAGCCCAGGGGCACAGG - Intronic
931865142 2:66401411-66401433 AGGTTACAGCCCAGAGGCACAGG + Intergenic
932427927 2:71654789-71654811 AAGTTACAGGCCAGGCACAGTGG + Intronic
933347761 2:81111010-81111032 AAGTCATAGCCAAAGGAGACAGG + Intergenic
933573905 2:84045118-84045140 AGATCACAGCTCAGGGACATAGG + Intergenic
934076820 2:88435564-88435586 AGGTCACAGCCCAGAGGCACAGG - Intergenic
934925066 2:98376510-98376532 AAGAGACAGCCCAGGCAGACCGG + Intronic
935580688 2:104753649-104753671 AATTCCCAGCCCATAGACACAGG + Intergenic
937255083 2:120549564-120549586 AAGCCACAGTCCAGGCACAGTGG - Intergenic
937435742 2:121879712-121879734 AGGTAACATCCCAGGGATACGGG - Intergenic
937553778 2:123129227-123129249 AAATCACAGCCCTTGGACACAGG + Intergenic
937721942 2:125109320-125109342 AAGTCACAGCCCAGAGACAGAGG - Intergenic
937850238 2:126625895-126625917 AGGTCACAGCCCAAGGACTCAGG + Intergenic
937934968 2:127236016-127236038 AGGTCACAGCACAGGAACACAGG + Intergenic
938389647 2:130894734-130894756 GAGCCACAGACCAGGGACAGAGG - Intronic
938947458 2:136226077-136226099 ATGTGACATCCCAGGGACCCTGG + Intergenic
938995512 2:136673726-136673748 AGATCACAGCCCAGGGGTACAGG + Intergenic
939976446 2:148722212-148722234 AGTTCACAGTCCAGAGACACAGG - Intronic
940120687 2:150261337-150261359 AAGTCAGAGCCCAGAGACACAGG + Intergenic
940594250 2:155769331-155769353 AGGTCACAGCACAGGGATATAGG - Intergenic
942108411 2:172656401-172656423 AGGTCACAGCCCAGGGACACGGG - Intergenic
943169103 2:184372646-184372668 AGATCACAGCCCTGGGTCACAGG + Intergenic
943210801 2:184963647-184963669 GAGTCACAGTCCAGTGACCCAGG - Intergenic
944476335 2:200110483-200110505 CAGTCCCAGCCCAGAGACAAGGG - Intergenic
945233920 2:207616903-207616925 GAGGCACAGACCAGGGACAGTGG + Intronic
946925034 2:224618054-224618076 AAGTCACAGGCCAGGCACGGTGG - Intergenic
947299735 2:228675774-228675796 GATTCACTGCCAAGGGACACTGG - Intergenic
948184951 2:236013793-236013815 AAGGCACAGCCCCAGGTCACAGG - Intronic
948506082 2:238427577-238427599 CAGGCACAGACCAGGGACAACGG + Intronic
949001803 2:241619043-241619065 AGGTCACGGCTCAGGGACACGGG + Intronic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1169277757 20:4244883-4244905 AGAGCAGAGCCCAGGGACACTGG - Intronic
1170147022 20:13186522-13186544 AGGTCACAGCCCAAAGACATAGG + Intergenic
1170903306 20:20487469-20487491 AGGTCACAGTCCAGGGGCACAGG - Intronic
1171004468 20:21450788-21450810 GAGTCACGTCCCAAGGACACAGG + Intergenic
1171137702 20:22711796-22711818 AAGTCACAGCGCAGAGAGGCTGG + Intergenic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1173680291 20:44874596-44874618 AGGTTATAGCCCAGGGACTCGGG + Intergenic
1174099467 20:48116156-48116178 AATTCACAGGCCAGGCGCACTGG - Intergenic
1174145872 20:48452165-48452187 AAGTCACAAACCAGGGTCCCTGG + Intergenic
1174925871 20:54759363-54759385 AGGTCGCATCCCAGAGACACTGG - Intergenic
1175370385 20:58484361-58484383 AAGGCACAGCACAGGGACTCTGG + Intronic
1175500251 20:59445067-59445089 AAATCCCAACCCAGGGACAGAGG + Intergenic
1175600894 20:60272071-60272093 AACTCAAATCCCAGGAACACAGG + Intergenic
1175608027 20:60327585-60327607 AAGCCAGAGCCCAGGGAAAGAGG + Intergenic
1175621440 20:60450933-60450955 AAGGCCCAGCCCAGTGCCACAGG - Intergenic
1175686937 20:61038092-61038114 CTGTCACAGCCCTGAGACACAGG - Intergenic
1175852641 20:62101971-62101993 GAGGCAGAGCCCAGGCACACAGG - Intergenic
1175948517 20:62569972-62569994 AAGTCCCAGGCCACGGACACGGG - Intronic
1176388370 21:6151016-6151038 AGGACACTGCCCAGGGGCACGGG - Intergenic
1177532520 21:22379480-22379502 ATGTCACAAGCCAAGGACACAGG + Intergenic
1177804197 21:25857711-25857733 AAGTCAAAGCCCACTGAGACTGG + Intergenic
1178193465 21:30314800-30314822 AGCTCACAGCTCAGGGACACAGG - Intergenic
1179025150 21:37673599-37673621 AGGACACAACACAGGGACACAGG + Intronic
1179156352 21:38854256-38854278 AGGTCACAGCCCAGGGACACAGG + Intergenic
1179295323 21:40056906-40056928 GAGGCACAGCCCTGGGACTCGGG - Intronic
1179350325 21:40604814-40604836 AAGTCACAATCCAGGGACTTGGG - Intronic
1179361549 21:40714124-40714146 AAGTCTCTGCCCAGGGCCGCAGG - Intronic
1179735102 21:43387232-43387254 AGGACACTGCCCAGGGGCACGGG + Intergenic
1181285433 22:21748538-21748560 AGGTCACAGCCCAGGGACACAGG + Intergenic
1181303076 22:21895718-21895740 CAGTCACAGGCCAGGCACAGTGG + Intergenic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1183062851 22:35346418-35346440 AAGCCACAGACCAAGGACTCAGG + Intronic
1183585456 22:38750711-38750733 CAGTCACAGCCCAGGGCACCAGG + Intronic
1184227033 22:43135011-43135033 AAGTCCCAGGCTAGGGCCACAGG + Intronic
1184253277 22:43272891-43272913 AAGTCACAGCCGCGTGACCCAGG - Intronic
1184827047 22:46959470-46959492 AAGTCACAGCACAGAGGCAGAGG - Intronic
949128405 3:472928-472950 AAGTGACTTCTCAGGGACACTGG - Intergenic
949348261 3:3097577-3097599 AAGTCACAGCTCAAGGACAGAGG + Intronic
949451194 3:4187080-4187102 AAGTCATAGGCCAGGCACAATGG + Intronic
949869795 3:8578793-8578815 AAGTCACTCCCCATGGACAATGG - Intergenic
950001316 3:9658625-9658647 AAGTCACAGAACAGGTAAACAGG - Intronic
950306807 3:11921590-11921612 AGGTCACAGCCTAGGCACACAGG - Intergenic
950597678 3:13999015-13999037 AGGTCACAGCCCATGGGCTCAGG - Intronic
950896722 3:16458907-16458929 AAGTTACAACCCAGGGCTACTGG + Intronic
951331334 3:21372427-21372449 AGGTCACCGCCCAGGGGCACAGG - Intergenic
951834998 3:26973163-26973185 AAGTCTCAGCCAAGGCTCACAGG - Intergenic
952336645 3:32409166-32409188 AAGTTACGGCCCAGGCACAGTGG - Intronic
953912072 3:46898333-46898355 CAGTCAGAGCCCTGGGACCCAGG - Intronic
953986060 3:47443879-47443901 AAGTCAAAGTCCAGGGAGAGAGG - Intronic
954014034 3:47670304-47670326 TAGTCACAGGCCAGGCACAGTGG + Intronic
954662309 3:52232593-52232615 AGGTCACAGCCCCAGGCCACAGG + Intronic
955147004 3:56329655-56329677 AGGTCACAGCCCAGGGGCACAGG + Intronic
956167295 3:66406291-66406313 AAGCCACAGCCCCGGGTCCCTGG - Intronic
956234814 3:67058108-67058130 AATTCACATCCAAGGGGCACAGG - Intergenic
956613969 3:71152606-71152628 AAGTCACAGACCTAGGGCACAGG - Intronic
956712973 3:72054426-72054448 AAGGCACAGGCCAGGCACAGAGG - Intergenic
958616380 3:96498371-96498393 AAATCACAGCCCTGTGATACAGG - Intergenic
958858860 3:99420639-99420661 AGGTCACAGCTGAGTGACACAGG - Intergenic
960749897 3:120936963-120936985 AGGTCACAGCCCAAGGACACAGG - Intronic
961335185 3:126171815-126171837 AGGTCACAGCCCAGGGGTGCAGG + Intronic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
961441295 3:126954850-126954872 AAGAGAGAGCCCAGGGAGACTGG + Intronic
963026716 3:140926888-140926910 AAGCCACAGCACAGGAAGACGGG - Intergenic
964013701 3:151921236-151921258 AAGTCACAGCCCACAGACACAGG - Intergenic
965036352 3:163443556-163443578 AGGTTACAGCCCAGGGGTACAGG + Intergenic
965037634 3:163462176-163462198 AGGTCACAGCTCAGAGACACAGG + Intergenic
965439866 3:168699425-168699447 AAGTCACAGGGCAGGCACAGGGG - Intergenic
965459157 3:168940118-168940140 AGGACACAGGCCAGGGATACAGG + Intergenic
966932610 3:184685619-184685641 AAATCACAGCCCTGTGAGACAGG - Intergenic
968268804 3:197383620-197383642 AACTCACAGGCCAGGCACAGTGG - Intergenic
968477874 4:820882-820904 AACTCACAGCCCAGCCCCACGGG + Intronic
968522414 4:1039963-1039985 TTGTCACAGCCTAGGGACACTGG + Intergenic
968600887 4:1508845-1508867 CTGCCACAGCCCAGGGAAACAGG - Intergenic
968620533 4:1601714-1601736 AGCTCACAGCCCAGGGGCAGGGG - Intergenic
969631556 4:8341651-8341673 CAGTCACTTCCCAGGCACACAGG - Intergenic
970132245 4:12884826-12884848 AAGCCAGAGCCCAGGGTCAAAGG - Intergenic
971208659 4:24594530-24594552 AGGTCACAGCTCAGGGACATAGG + Intergenic
971477808 4:27088820-27088842 AGCTCACAGCCCAGGGACACGGG - Intergenic
971821467 4:31561067-31561089 AGTTCACAGTCCAGGGACACAGG + Intergenic
972256229 4:37358561-37358583 AGGTCAGAACCCAGGGATACTGG - Intronic
973130454 4:46641871-46641893 AAGATACAGCCCAGGCACAGTGG + Intergenic
974039357 4:56844601-56844623 CAGTCACAGACCAGGGACAACGG + Intergenic
974573549 4:63687627-63687649 AGGTCATAGCCCAGGGATACAGG + Intergenic
975512392 4:75208310-75208332 AGGTTCCAGCCCAGGGACACAGG - Intergenic
975597063 4:76057683-76057705 AATTCACAGCCATGTGACACTGG - Intronic
976043066 4:80911161-80911183 AAGGAACAGCCCAGGGACATAGG - Intronic
976653008 4:87456283-87456305 GGGTCACAGCCCAGGGCCACAGG - Intronic
976723897 4:88197038-88197060 AATTCACAGCCTAGGGGCACAGG + Intronic
976947118 4:90783812-90783834 AAGACACAGCCCAGGGATACAGG + Intronic
977616404 4:99091449-99091471 AGTTTACAGCCTAGGGACACAGG + Intergenic
978064771 4:104383242-104383264 AAGTCACAGGCCAAGCACATAGG - Intergenic
978218537 4:106239288-106239310 AGGTCACAGCCCAGGAACACAGG + Intronic
978582099 4:110242488-110242510 AAGTCATAGCCCAGGCGCAGTGG + Intergenic
978663588 4:111155534-111155556 ATGTCACAACCCAGGGACACAGG - Intergenic
979023791 4:115540770-115540792 AGGTTACAACCCAGGGAAACTGG - Intergenic
979186175 4:117796762-117796784 AAGTCACACCACAGGATCACAGG + Intergenic
979272055 4:118774660-118774682 AAGTCACAGACCAGCGAGAATGG - Intronic
979716309 4:123842965-123842987 AGGTCACAGCCCAGAGGCACAGG + Intergenic
979971591 4:127142396-127142418 ATGTCACAGCCCAGGTACACTGG + Intergenic
980338089 4:131501330-131501352 AGGTCACAGGCCAGGGACACAGG + Intergenic
980509111 4:133761312-133761334 AAGTCACAGCCCAGGGATGCAGG - Intergenic
981491364 4:145343702-145343724 AGATGACAGCCCAGGGGCACAGG + Intergenic
981521150 4:145663703-145663725 AAGTCACAGCCCAGAAACACAGG + Intergenic
981821016 4:148887709-148887731 AAGACACAGTCCAGTCACACAGG + Intergenic
982537941 4:156629757-156629779 TACTCACAGCCCAGGGAGAAGGG - Intergenic
982571576 4:157057230-157057252 AGCTCACAGGCCAGAGACACAGG - Intergenic
984137710 4:175961878-175961900 AAGTTACAGCCCAAGGGCACAGG + Intronic
984508937 4:180655359-180655381 AAGTCACAAGCCAGGCACAGTGG - Intergenic
985832067 5:2241066-2241088 AAGCCGCAGCCCAGGAACGCAGG + Intergenic
986277239 5:6287253-6287275 AGGTCACAGCCCACAGACACAGG + Intergenic
986324666 5:6663353-6663375 ATCTCAGAGCCCAGCGACACTGG + Intronic
988012283 5:25505006-25505028 AGTTCACAGTCCAGAGACACAGG - Intergenic
988153273 5:27415423-27415445 AGGTCACAGCACAGGTACACAGG - Intergenic
988238403 5:28575802-28575824 AGGCCACTGCCCTGGGACACAGG - Intergenic
989266258 5:39477400-39477422 AAGTCACAACCTAGGGACCAGGG + Intergenic
989462127 5:41712936-41712958 AGTTCACAGTCCAGGAACACAGG - Intergenic
989504994 5:42217056-42217078 AAGTGTCAGCCCAGTGACAATGG - Intergenic
989554339 5:42774612-42774634 AACTCACAGTCCAAAGACACAGG + Intronic
991163488 5:63533135-63533157 AAGTCACAGCCTAGGGTCAATGG + Intergenic
991450264 5:66743673-66743695 GAGACTCAGCCCAGGGAAACAGG + Intronic
991647373 5:68814835-68814857 AGGTCACAGCCCAAAGACACAGG - Intergenic
991984798 5:72274064-72274086 AAGACACAGGCCAGGCACAGTGG + Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994770180 5:103971978-103972000 CATTCACAGCCCAGAGGCACAGG + Intergenic
995321304 5:110837360-110837382 AGGTCACAGCCCAGGGACACAGG - Intergenic
996553147 5:124750785-124750807 AGATGACACCCCAGGGACACAGG - Intergenic
996701877 5:126458031-126458053 AAGTAAAATCCCAGGGAAACTGG - Intronic
997873193 5:137523164-137523186 AGGTCACAGTCCAGGGGCACAGG + Intronic
997926769 5:138037468-138037490 AAGTCTCATTCCAGTGACACTGG - Intronic
998961448 5:147491233-147491255 CATTCACAGTCCAGGGTCACAGG + Intronic
999846175 5:155483130-155483152 AAATCAAAGCCCTGGGATACTGG + Intergenic
1001324313 5:170710152-170710174 AAATCACAGTCCAGGCACAGTGG - Intronic
1001672456 5:173485477-173485499 AAGTCACAGCCAAAATACACGGG + Intergenic
1003185415 6:3826169-3826191 ACGTCACAGCCCAGGCAGCCAGG + Intergenic
1003250112 6:4420379-4420401 GGGTCACAGCCCAGGGGCACAGG + Intergenic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1004409066 6:15363509-15363531 AAGACACAACACAGGGAAACAGG - Intronic
1005186683 6:23170499-23170521 AGGTCACAGCCCTGAGACACAGG + Intergenic
1007230973 6:40347626-40347648 ACAGCAAAGCCCAGGGACACAGG + Intergenic
1007303087 6:40883223-40883245 AAGTCACTGCTCTGGGAAACTGG + Intergenic
1007899222 6:45394603-45394625 AGTTCACAGCCCAGGGAGCCAGG - Intronic
1009627839 6:66160028-66160050 AGGTCACAGCCCAGGGATACAGG + Intergenic
1010934287 6:81842475-81842497 TGGAGACAGCCCAGGGACACAGG + Intergenic
1011300397 6:85866965-85866987 AACTCACACCCCACCGACACAGG - Intergenic
1011693972 6:89895476-89895498 CACTGCCAGCCCAGGGACACGGG - Exonic
1012345736 6:98183482-98183504 AAGTCACAGACAAGAGAGACAGG - Intergenic
1013572375 6:111441945-111441967 CGGTCACACCCCCGGGACACAGG - Intronic
1014084288 6:117325302-117325324 AAATCACAGCTAAGGGGCACAGG + Intronic
1014203343 6:118627996-118628018 AAGTTACAACCCAGGGGCACCGG + Intronic
1014329843 6:120049438-120049460 AAGTCAGAGCCCAGGAGCTCAGG - Intergenic
1014971274 6:127818240-127818262 AGGTCACAGCCTAGAGACACAGG + Intronic
1015757402 6:136621611-136621633 AATTCACAGCCCAGGGGCACTGG - Intronic
1015787099 6:136929577-136929599 AGGTCAGAGACTAGGGACACAGG - Intergenic
1016104373 6:140144032-140144054 AAGTCATAAACTAGGGACACAGG - Intergenic
1016128539 6:140436469-140436491 AGGTCATGGGCCAGGGACACAGG - Intergenic
1017574450 6:155786633-155786655 AGGTCATAACCCAGGGAAACAGG + Intergenic
1017664223 6:156703700-156703722 CAGTGTCTGCCCAGGGACACAGG - Intergenic
1017712090 6:157179697-157179719 AAATCTCAGCCCAGTGACTCTGG + Intronic
1017956944 6:159186601-159186623 CAGGCAGAGCCCAGAGACACAGG + Intronic
1018048038 6:159981801-159981823 ATGTCAGAGCCCAGGGAACCAGG - Intronic
1018703303 6:166445206-166445228 AAGTCACGGCCCAGTCACAGTGG + Intronic
1018953538 6:168393562-168393584 ACGTCAGAGCCAAGGGACTCTGG + Intergenic
1019027388 6:168979643-168979665 AAGTCACAGTCCAGGAACAGAGG + Intergenic
1019141128 6:169943921-169943943 AGTTCACAGACCAGGGGCACAGG + Intergenic
1019417872 7:935532-935554 GAGGCTCAGCCCAGGGACCCCGG + Intronic
1019819102 7:3227489-3227511 AGGTCACAGCACAGGGCCTCAGG - Intergenic
1019837043 7:3398376-3398398 AGGTCACAGCCCAGGGACTCAGG - Intronic
1020129114 7:5549482-5549504 CAGTTACAGCCCAGAGACCCAGG - Intronic
1020907725 7:14085433-14085455 AAGTCACATCCCAGGGATTCAGG - Intergenic
1023252852 7:38284211-38284233 AAATCATAGCCCAAGGACACTGG - Intergenic
1023705603 7:42938617-42938639 AAGTTAAAGGCCAGGCACACTGG - Intronic
1023723984 7:43123444-43123466 ATGTCAAAGCGCAGGGTCACAGG - Intronic
1023828458 7:44025229-44025251 ATGTCTGAGCCCTGGGACACTGG + Intergenic
1023942106 7:44775816-44775838 AAGTCACAGCTCGGGGTCAGGGG + Intergenic
1023979650 7:45061247-45061269 AGGCCACGGCCCAGGGACACAGG - Intronic
1024082735 7:45868539-45868561 AAGCCACAGACCAGGGACTGTGG - Intergenic
1024388029 7:48775533-48775555 TAGTCAAAGCCCAGGGACAGTGG - Intergenic
1024466284 7:49714463-49714485 AAGGCACAGCCCAGTGTCAAGGG + Intergenic
1024517147 7:50268611-50268633 ATGTCACATCCCTTGGACACAGG - Intergenic
1024951240 7:54862871-54862893 AGATCGCAGTCCAGGGACACAGG - Intergenic
1024964784 7:55014834-55014856 AGTTCACAGTCCAGGGACACAGG - Intergenic
1024984456 7:55183097-55183119 CAGCCACAGCCCAGGGATGCTGG - Intronic
1025972728 7:66343026-66343048 AAGTCACGGCCCAGGCACACAGG + Intronic
1027684952 7:81268061-81268083 AAGTTACATCACATGGACACAGG - Intergenic
1028317269 7:89419139-89419161 AGGTCACAGCTCAGAGACACAGG - Intergenic
1028653010 7:93171380-93171402 AGGTCACAGCACAGAGACACAGG + Intergenic
1029266870 7:99349348-99349370 AACTTACAGGCCAGGCACACTGG - Intronic
1029419834 7:100466851-100466873 AACTCCCACCCCGGGGACACGGG + Exonic
1029445286 7:100608586-100608608 AAGTCACAGGCCAGGTGCAGTGG + Intergenic
1029756759 7:102578656-102578678 ATGTCTGAGCCCTGGGACACTGG + Intronic
1031535063 7:122923234-122923256 AAGTCACAAACCAAGTACACTGG + Intergenic
1032528229 7:132596417-132596439 AAGCCACAGCCCCAGGACGCTGG + Intronic
1032774352 7:135095216-135095238 AGGTCATAGCCCAGGAACACAGG + Intronic
1033366918 7:140678824-140678846 AAGCCAGACCCCAGGGAGACGGG + Intronic
1034816832 7:154179103-154179125 GAGCCACAGCCCAGGGAAAGGGG - Intronic
1035275735 7:157746875-157746897 AGCCCACAGCTCAGGGACACAGG - Intronic
1035275756 7:157746998-157747020 AGCCCACAGCTCAGGGACACAGG - Intronic
1035275778 7:157747121-157747143 AGCCCACAGCTCAGGGACACAGG - Intronic
1035275978 7:157748187-157748209 AGCTCACAGCTCAGGGACGCAGG - Intronic
1035276012 7:157748351-157748373 AGCTCACAGCTCAGGGACGCAGG - Intronic
1035276030 7:157748433-157748455 ACCCCACAGCTCAGGGACACAGG - Intronic
1035276100 7:157748843-157748865 AGCCCACAGCTCAGGGACACAGG - Intronic
1035276202 7:157749376-157749398 ACCCCACAGCTCAGGGACACAGG - Intronic
1035276217 7:157749458-157749480 AACCCACAGCTCAGGGACACAGG - Intronic
1035276261 7:157749704-157749726 AGCTCACAGCTCAGGGACACAGG - Intronic
1035276298 7:157749868-157749890 ACCCCACAGCGCAGGGACACAGG - Intronic
1036025939 8:4909272-4909294 AAGTCATAGCCCTGAAACACAGG - Intronic
1036093923 8:5702515-5702537 ACATCACAGCCCAGAGACACTGG - Intergenic
1036922581 8:12872102-12872124 AAGTCCCAGCCCATGGAGGCGGG - Intergenic
1037048794 8:14342933-14342955 CACACACAGCCCAGGGACCCTGG - Intronic
1037119173 8:15262518-15262540 AGGTCACAGTCCAGGGAAACAGG + Intergenic
1037196447 8:16196710-16196732 AGGTCACAGTCCGGGGACAAGGG + Intronic
1037780961 8:21868816-21868838 AAGTCACAGCACAGGCGGACGGG - Intergenic
1039231994 8:35458620-35458642 AGAGCACAGCCCAGGGATACTGG + Intronic
1039347392 8:36722661-36722683 AAGTTACAGCTCAGGGACATAGG - Intergenic
1040529144 8:48251651-48251673 AAGACACAGGCCAGGCACAGTGG - Intergenic
1040767723 8:50934978-50935000 AAGTCACATCCTAAGGGCACAGG + Intergenic
1040803625 8:51370369-51370391 ATGTCCCATCCCAGGGACATTGG + Intronic
1040908575 8:52494527-52494549 AAGACACAGCCAAGGAACGCAGG + Intergenic
1041163836 8:55072082-55072104 AGATCATACCCCAGGGACACAGG + Intergenic
1042053710 8:64739213-64739235 AGGTCACAGCCCAGGAATACAGG + Intronic
1042498986 8:69488757-69488779 AACTCACAGCCCAGGGAAGGAGG + Intronic
1043213948 8:77561182-77561204 AGATCACAGTTCAGGGACACGGG + Intergenic
1043356794 8:79423127-79423149 AAATCTCAGTCCAGGGACAGGGG - Intergenic
1044140923 8:88651407-88651429 AGGTCACAGTCCAGAGACATGGG - Intergenic
1045434406 8:102146799-102146821 AGGCCACAGCCCAGGGACACAGG + Intergenic
1045595994 8:103657171-103657193 GAGTCACAGCCCAAGAGCACAGG + Intronic
1045707366 8:104941767-104941789 GAGTCACAGCCCCAAGACACAGG - Intronic
1045980358 8:108179332-108179354 AAGTCACAGCCCAAGGACACAGG + Intergenic
1045996345 8:108366809-108366831 AGGTCACAGTCCAGAGGCACAGG - Intronic
1046193274 8:110827467-110827489 ACATCACACCCTAGGGACACAGG - Intergenic
1046444711 8:114302480-114302502 AAGTCAAAGCCCGGGCACAGAGG - Intergenic
1047523253 8:125611916-125611938 CAGTCCCAGCCCAGAGAAACAGG - Intergenic
1047722723 8:127656601-127656623 AAGTCACTACAAAGGGACACAGG + Intergenic
1047896899 8:129376268-129376290 AGGTCACAGCCCAGGGATACAGG + Intergenic
1048394058 8:133996576-133996598 AGGTCATAGCCTAGGAACACTGG - Intergenic
1049307609 8:141913955-141913977 AGGTCACATCCCAGAGGCACAGG + Intergenic
1049398058 8:142411080-142411102 TAGTCAGAGGCCTGGGACACTGG - Intergenic
1049456585 8:142694768-142694790 CAGTCACAGCCCATGGTCACAGG - Intergenic
1050109801 9:2202410-2202432 AGGTCACAACCCAGGTGCACAGG + Intergenic
1051286191 9:15499584-15499606 AAGTCACAGGCCAGGCACGGTGG + Intronic
1051981362 9:23023518-23023540 AGGTCACAGCCCAAGGACACAGG - Intergenic
1052050324 9:23840080-23840102 AAGTCATATACCAAGGACACAGG - Intergenic
1052249481 9:26380515-26380537 AAATGACAGCACAGGGAGACTGG - Intergenic
1052481627 9:29035560-29035582 AAGTCAAAACCAAGGTACACTGG - Intergenic
1052783341 9:32803468-32803490 AATTCACAACCCAGGGGCACAGG + Intergenic
1053321099 9:37099491-37099513 AAGACACAGGCCAGGCACAGTGG - Intergenic
1053554554 9:39122006-39122028 AGGTCACAGTCCAGGAAGACAGG + Intronic
1053818646 9:41942127-41942149 AGGTCACAGTCCAGGAAGACAGG + Intronic
1053820189 9:41958577-41958599 AGGTCACAGCCCAGAGGCACAGG - Intronic
1054108910 9:61085785-61085807 AGGTCACAGTCCAGGAAGACAGG + Intergenic
1054110463 9:61102276-61102298 AGGTCACAGCCCAGAGGCACAGG - Intergenic
1054610394 9:67228849-67228871 AGGTCACAGCCCAGAGGCACAGG + Intergenic
1054611947 9:67245340-67245362 AGGTCACAGTCCAGGAAGACAGG - Intergenic
1054844218 9:69775524-69775546 AGGTCAAAGCCCAAGGACTCAGG - Intergenic
1055581374 9:77710444-77710466 AATTCACAGCCCAGGGGCACAGG - Intergenic
1055875790 9:80939921-80939943 AAGTCATAGCCCAGGAACACAGG + Intergenic
1055976913 9:81964730-81964752 ACATCACAACCCAGGGACACAGG - Intergenic
1055987596 9:82067556-82067578 AGGTCAGAGCCCAGGGACTCAGG - Intergenic
1056005053 9:82260799-82260821 AGGTCACAGTCCAGGGGCACAGG - Intergenic
1056231671 9:84552178-84552200 AGTTCACAGTCCAGGGACACAGG - Intergenic
1056378785 9:86038576-86038598 CATTCACAGCCAAGGGACTCAGG + Intronic
1056395695 9:86179346-86179368 AACCCACAGCCCCAGGACACAGG - Intergenic
1056593327 9:87983450-87983472 AAGTCAAAGGCCAGGCACAGTGG + Intergenic
1057532135 9:95858332-95858354 GAGTGACATCCCAAGGACACAGG - Intergenic
1057703237 9:97378789-97378811 AAGTCACCCTCCAGGGAAACAGG + Intergenic
1058015000 9:100021277-100021299 ATGTCACAGGAAAGGGACACTGG - Intronic
1058434716 9:104951748-104951770 AAGTCTCAGCCCAGGGCACCTGG + Intergenic
1058794416 9:108483952-108483974 AAATCACAGCCCAGACAGACAGG - Intergenic
1058947826 9:109875416-109875438 AAGTCACAGCTCAGGAAGACAGG - Intronic
1059381308 9:113928841-113928863 AGATCACAGCCCAGGGATGCAGG - Intronic
1059436104 9:114277355-114277377 AAATGACACCCCAGGGAGACTGG - Intronic
1060195859 9:121622895-121622917 AAGTCAAAGCCCAGTGGCCCTGG - Intronic
1061495572 9:130972325-130972347 GAGTCACAGCACAGAGACAGAGG - Intergenic
1061495575 9:130972361-130972383 GAGTCACAGCACAGAGACAGAGG - Intergenic
1061623992 9:131830081-131830103 AAATCACAGACCAGGGTCAGAGG + Intergenic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1061963532 9:134000130-134000152 AAGACACGGCCAAGGGACACTGG + Intergenic
1062280866 9:135751072-135751094 AAGGCTCAGCCCTGGGACCCGGG - Intronic
1203479886 Un_GL000224v1:2580-2602 AAGTGAGATCCCATGGACACAGG - Intergenic
1203480850 Un_GL000224v1:8876-8898 AAGTGAGATCCCATGGACACAGG - Intergenic
1203481813 Un_GL000224v1:15193-15215 AAGTGAGATCCCATGGACACAGG - Intergenic
1186280615 X:7988957-7988979 AAGTCACTGCCCCGAGACACCGG - Intergenic
1186822523 X:13305125-13305147 ATGTCACAGCTCAGGGACTCAGG - Intergenic
1187181628 X:16947702-16947724 AAGTTGCAGAACAGGGACACGGG + Intronic
1187442477 X:19332662-19332684 GAGTCAAAGCCCAGGGCCCCAGG + Intergenic
1187677755 X:21734644-21734666 AAGTCAAAGCCAAAAGACACAGG - Intronic
1187759743 X:22568064-22568086 AAGTCACAACCTAGGGACGTAGG + Intergenic
1187871947 X:23771824-23771846 TAGTCTCAGCCCAGGTACTCAGG + Intergenic
1188385574 X:29553507-29553529 GTTTCACAGTCCAGGGACACAGG - Intronic
1189291349 X:39888074-39888096 AAATGACAGCCCAGGGCCTCAGG - Intergenic
1189725648 X:43965874-43965896 AAGTCTCAGCCCAGGGCTTCTGG - Intronic
1190138883 X:47823370-47823392 AGGTCACAGCCCAGAGACTAAGG + Intergenic
1191041844 X:56090099-56090121 AGGTCACAGCCCAGAAGCACAGG + Intergenic
1191704328 X:64078442-64078464 AAGTTATAGCCCAAGGTCACAGG - Intergenic
1192251834 X:69420228-69420250 AGTTCACAGTCCAGGGACACAGG - Intergenic
1192633276 X:72793018-72793040 AAGATCCAGGCCAGGGACACGGG - Intronic
1192648433 X:72927783-72927805 AAGATCCAGGCCAGGGACACGGG + Intronic
1193036875 X:76960830-76960852 AGGTCACAGTCCTGGGGCACAGG - Intergenic
1193863262 X:86697122-86697144 AAGTCACAGCCCAAGGATACAGG + Intronic
1194105617 X:89763198-89763220 AGGTCACAGCCCAGGGACACAGG - Intergenic
1194239020 X:91421204-91421226 AGGTCATAGCTCAGGGAAACAGG + Intergenic
1194649413 X:96497802-96497824 GAGTCACAGCCCAGGTCCATAGG + Intergenic
1194909603 X:99624752-99624774 AAGTCACAGCCTAAAGACGCAGG + Intergenic
1195219072 X:102729371-102729393 AAATCAAAGCCCAGGGACACAGG + Intronic
1195307332 X:103596969-103596991 AGGTCACAGGCCAGAGACATAGG - Intergenic
1195534348 X:105994334-105994356 AAGTCACAGCTCAGAAATACAGG - Intergenic
1196480840 X:116145810-116145832 AATTCACAGCCCAGGGACATAGG - Intergenic
1196853414 X:119960800-119960822 AGGTCACAGCCCAGGGACACAGG - Intergenic
1196858893 X:120008891-120008913 AGGTCACAGCCCAGGGACACAGG + Intergenic
1197033969 X:121852995-121853017 AGGTCATAGCCCAGTGGCACAGG - Intergenic
1197038068 X:121902337-121902359 AAGTTACAGCCCAGATACACAGG - Intergenic
1197638242 X:128940516-128940538 AATTCACAGCCCAGGAATAGGGG + Intergenic
1198489072 X:137120136-137120158 AGTTCACAGTCCAGGGGCACAGG + Intergenic
1198859501 X:141054665-141054687 AAGTCCCAGGCCAGGCACAGTGG + Intergenic
1198903193 X:141532725-141532747 AAGTCCCAGGCCAGGCACAGTGG - Intergenic
1199249652 X:145645888-145645910 AAGTCATATCCCAGAGACAAAGG - Intergenic
1199795191 X:151188619-151188641 AGCTCACAGCCTAGGGACACAGG + Intergenic
1200094983 X:153654339-153654361 AATTCACAGTCCAGGGGCATAGG - Intergenic
1200457580 Y:3411023-3411045 AGGTCACAGCCCAGGGACACAGG - Intergenic
1200812714 Y:7502016-7502038 AAGGAGCAGCCCAGGGACAAGGG - Intergenic
1200834348 Y:7718221-7718243 AAGTCACAGGCCTGGGAGAGGGG + Intergenic
1201068075 Y:10118461-10118483 AAATAACAGTCCAGGGACAGTGG + Intergenic
1201351510 Y:13047702-13047724 AAGTCACAGCCCGGGGGCACGGG + Intergenic