ID: 916930692

View in Genome Browser
Species Human (GRCh38)
Location 1:169575537-169575559
Sequence GAGAACAGATAGAAGACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916930692 Original CRISPR GAGAACAGATAGAAGACTCC AGG Intronic
902085785 1:13860847-13860869 CAAAACAGATAGATCACTCCAGG - Intergenic
902529670 1:17082669-17082691 GAGAACTGTTAGACGAATCCAGG + Intronic
902753780 1:18536094-18536116 GTGGACAGATAGATGAATCCTGG - Intergenic
904398558 1:30240495-30240517 GAGGAGAGATAGAAGGCTGCAGG - Intergenic
905029778 1:34874200-34874222 AGGAAAAGATAGAAGGCTCCAGG + Intronic
905333665 1:37227891-37227913 GAGCAGAGATAGAAGAAACCTGG + Intergenic
905972766 1:42154033-42154055 AAGACCAGATAGAAGACTATGGG + Intronic
906928779 1:50147995-50148017 GAGAACAGATAGAAGAAATTTGG + Intronic
907083898 1:51651081-51651103 GGGAACACACAGAAGACTCTGGG + Intronic
907537786 1:55180618-55180640 GAGAACAGAAAGATGAGTTCAGG - Intronic
908932751 1:69337147-69337169 AAAAACAGATAGAAGAGGCCGGG - Intergenic
912993101 1:114509065-114509087 GAGACCAGTTAGGAGAATCCTGG - Intronic
915325830 1:155080760-155080782 GAGGACAGAAAGGAGGCTCCCGG - Intronic
915919584 1:159964371-159964393 GAGAACAGATTAAAAGCTCCCGG - Intergenic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
918575926 1:186060228-186060250 GAAAACAGATAGAATACCCCTGG + Intronic
1062789105 10:290079-290101 GAGAACAGAGAGGAGACGCTGGG + Intronic
1063437934 10:6049611-6049633 AAGCACAGACAGAAGAGTCCCGG - Intronic
1065170204 10:23019496-23019518 GAGAACAAATAGAAAATACCAGG - Intronic
1065912527 10:30321478-30321500 GAGAAGAGAAAGCAGATTCCAGG + Intronic
1068367839 10:56075038-56075060 TAGAACAGAAAAAATACTCCTGG + Intergenic
1068525650 10:58126546-58126568 GAGAACAGATAGACAAATCATGG + Intergenic
1068826723 10:61448330-61448352 GAGAGAAGAGTGAAGACTCCAGG - Intronic
1069878064 10:71575114-71575136 GAGGACAGCTAGCAGCCTCCAGG - Intronic
1070278938 10:75034831-75034853 GAAAACAGAGAGAACACTCCCGG - Intergenic
1071302345 10:84265426-84265448 GAGAACAGAGGGAAGACTTAAGG - Intergenic
1074039183 10:109771181-109771203 GGCCACAGATAGAAGACTCATGG - Intergenic
1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG + Intergenic
1076733609 10:132449516-132449538 GAGAACAGACAGAACCTTCCAGG - Intergenic
1076799905 10:132816260-132816282 GAGAACATGCAGAAGACGCCAGG - Intronic
1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG + Exonic
1077724925 11:4664978-4665000 GAGAACAGATAAATCAATCCAGG - Intergenic
1077838189 11:5943616-5943638 TAGAACAGATAAAGGACTCCAGG + Intergenic
1078581333 11:12541755-12541777 GAAAAGAGAAAGAAGAATCCTGG + Intergenic
1079181189 11:18194924-18194946 AGGAACAGATAGGAGAATCCTGG - Intronic
1083236418 11:61353765-61353787 GAGAACAGAGAGAACCCACCTGG + Exonic
1084043398 11:66555510-66555532 GGGACAAGATAGAGGACTCCTGG - Intronic
1085200271 11:74697646-74697668 GAGAACAGACAGAAGAAAACAGG - Intronic
1085368148 11:75972295-75972317 GAGAAAATACAGAAGACTCTGGG - Intronic
1085752959 11:79177983-79178005 AAGAACAGGTAGGAGGCTCCTGG + Intronic
1085753012 11:79178404-79178426 TAGAACAGAAAGAAGAGCCCTGG + Intronic
1086980699 11:93195340-93195362 GAGGAGACATGGAAGACTCCAGG - Intronic
1087218938 11:95524887-95524909 GAGAACAGACAGCAGATCCCTGG + Intergenic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1090230867 11:125102639-125102661 AAGAACTGGTAGAAGACACCAGG + Exonic
1091884189 12:4003989-4004011 GGGAAAGGATAGAAGACTTCAGG - Intergenic
1092511600 12:9162671-9162693 GAGAAAAGATAGAAACATCCTGG + Intronic
1094443244 12:30502329-30502351 GAGAACAAATACAAGATTTCTGG - Intergenic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1094667545 12:32536346-32536368 AAGAGTAGATAGGAGACTCCTGG + Intronic
1096775889 12:53963841-53963863 GAGTACAGAGAGAATAATCCGGG - Intergenic
1097078772 12:56413981-56414003 GAGGACATATGGAAGACACCAGG + Intergenic
1097409237 12:59229890-59229912 GAGAAAAGATGGAAAACACCAGG + Intergenic
1097949505 12:65412014-65412036 GAGAACCTATTGAAGAATCCAGG + Intronic
1099194934 12:79604508-79604530 GAGAAGAAATACAAGACTCAAGG + Intronic
1101568071 12:105928298-105928320 GAGAATAAACACAAGACTCCAGG + Intergenic
1102527951 12:113525281-113525303 GAGAACAGAGAGGAGACACCTGG - Intergenic
1106242107 13:27920612-27920634 GGGAACAGAGAGAAGGCTCCTGG - Intronic
1107051407 13:36054366-36054388 GGCAAAAGATAGAAAACTCCTGG - Intronic
1107337083 13:39366640-39366662 GGCAAAAGATAGGAGACTCCTGG + Intronic
1109205776 13:59481174-59481196 TAGAAGAGACAGAAGACTCCAGG + Intergenic
1110554060 13:76838759-76838781 GAGAAGCCATAGAAGCCTCCAGG + Intergenic
1111021611 13:82458665-82458687 GACACCAGGTATAAGACTCCCGG - Intergenic
1112498806 13:99926510-99926532 GAGACCACAGAGAAGACGCCAGG - Intergenic
1112589031 13:100747084-100747106 GAGAACAGATAGCTGAGTTCTGG - Intergenic
1113969850 13:114180501-114180523 GAGGGGAGAGAGAAGACTCCAGG - Intergenic
1115474348 14:33799672-33799694 GAGAAGAGAGAGAAGACACCAGG - Intronic
1116040753 14:39683823-39683845 GAGAACTGAAAGAAGACATCAGG - Intergenic
1117080025 14:52142223-52142245 GAGCACAGATAACACACTCCAGG - Intergenic
1117359753 14:54961103-54961125 AAGAACAGATAATAGACTACTGG - Intronic
1119668971 14:76504443-76504465 AAGAACAGCTAGAAGACCACTGG + Intergenic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1125269088 15:37918363-37918385 GAGAAGAGATGGAAAATTCCTGG - Intergenic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1130760190 15:86811330-86811352 GAGAACAGTCAGAAGGCTACTGG + Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG + Intergenic
1138231968 16:55344553-55344575 CAGAACAGATGGAAGATTCCTGG - Intergenic
1139058418 16:63217801-63217823 GAGAACAGATTCAACATTCCAGG + Intergenic
1139496614 16:67325039-67325061 GAGAACAGAAAGCAGAATCAAGG - Intronic
1139498841 16:67343730-67343752 TAGAACATATATAAGACTCCTGG + Intronic
1140039127 16:71393909-71393931 AATAAGAGAGAGAAGACTCCTGG - Intergenic
1140219592 16:73033880-73033902 GTCAACAGTGAGAAGACTCCAGG + Intronic
1141126539 16:81404585-81404607 GAGGACAGTTAGGAGACTGCTGG - Intergenic
1143128501 17:4660656-4660678 GAGAACAGAGAGAGGACTAGTGG + Intergenic
1143921116 17:10331789-10331811 GAGAACATAGAGAGGACTCCAGG - Intronic
1144518657 17:15939373-15939395 GTGAAAAGACAGAAGGCTCCAGG - Intergenic
1147612347 17:41809490-41809512 GAGAACAGACAGCAGCCTCAGGG - Intronic
1153968397 18:10202784-10202806 AAAAACAAATAGATGACTCCGGG - Intergenic
1155210603 18:23597350-23597372 GAGCAAAGATAGAAGACAGCAGG - Intergenic
1158437856 18:57446541-57446563 TAGTGCAGTTAGAAGACTCCCGG - Intronic
1158492821 18:57925503-57925525 CAGAACAGGTAGGAGAGTCCAGG - Intergenic
1163084143 19:14967187-14967209 GAGAATATATACAAGGCTCCAGG + Intronic
1164895805 19:31876687-31876709 GTGGACAGATGGAAGACTCCGGG + Intergenic
1166628080 19:44379053-44379075 CATAAAAGATAGGAGACTCCAGG + Intronic
925461842 2:4069953-4069975 GAGAACAGATTGAAGGCTGTGGG - Intergenic
927082852 2:19647716-19647738 GAAAAGAGATAGAAGACTTCAGG + Intergenic
927386259 2:22537312-22537334 GAGAACAGATAAAAGAATGAGGG - Intergenic
927889897 2:26741735-26741757 GAGAACAGTGAGAAGAGCCCGGG + Intergenic
928855530 2:35798587-35798609 GAAAAGAGAAAGAAGACTCTAGG - Intergenic
932113243 2:69020991-69021013 GAGAAAAGTTAGAGGACTCTAGG + Intronic
932490356 2:72116176-72116198 GAGAACATAGAGAAGAGTCAGGG - Intergenic
932682057 2:73834910-73834932 GAGAAAAGCAAGATGACTCCAGG + Intronic
933976772 2:87518417-87518439 GATAACAGACAGAAGGCTGCTGG - Intergenic
934872428 2:97879276-97879298 AATAAGAGACAGAAGACTCCTGG + Intronic
935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG + Intergenic
936243767 2:110809167-110809189 GAAGAAAGAAAGAAGACTCCTGG - Intronic
936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG + Intergenic
937062945 2:118993634-118993656 AAGAACAGAGAGAAGATTCAGGG + Intronic
938077581 2:128347965-128347987 GAGCAGAGAAAGAAGACTGCAGG - Intergenic
938545517 2:132326095-132326117 CATAAAAGATAGGAGACTCCAGG - Intergenic
939007889 2:136810076-136810098 GAGAAGTGGTAGGAGACTCCGGG + Intronic
942959745 2:181815830-181815852 GACAAAAGATATGAGACTCCTGG - Intergenic
944019442 2:195084111-195084133 GAGAAGAGATAGAAGACTCAAGG + Intergenic
945506929 2:210653149-210653171 GAGAAAAGATAGAATACACGTGG + Intronic
947739738 2:232479658-232479680 TGGAAAAGATAGAAGAGTCCAGG + Intergenic
1170452085 20:16493463-16493485 GAGACCAGATAGATGAGTCTTGG - Intronic
1170975309 20:21158673-21158695 GAGAACAGCTAGAGGACTAAAGG + Intronic
1171874374 20:30558851-30558873 CATAAAAGATAGGAGACTCCAGG - Intergenic
1172355265 20:34275465-34275487 GAGAAGACATTGAAGACACCAGG - Intergenic
1173251238 20:41365261-41365283 GAGAACAGACAGAAGAGACATGG - Intronic
1173343009 20:42170392-42170414 GAGAAAAGATAGAAGAATAAAGG + Intronic
1173496949 20:43526378-43526400 GAGAAGAGAGAGTAGACTTCAGG - Intronic
1173509324 20:43614049-43614071 GAAAACATATAGAAGCCTTCTGG - Intronic
1173780041 20:45748263-45748285 GACAGCAGATAGAAGAATCCCGG - Intronic
1174162486 20:48561547-48561569 GAGGACAGACTGAAGACCCCTGG + Intergenic
1175352723 20:58336844-58336866 GTGACCACATAGAAGGCTCCAGG - Intronic
1176655336 21:9583825-9583847 GAGAACACAAAGAAAACTCAAGG - Intergenic
1178059098 21:28832363-28832385 GAGAAGAACAAGAAGACTCCAGG - Intergenic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1183654454 22:39176682-39176704 GGGGAGAGGTAGAAGACTCCTGG + Intergenic
1183812005 22:40265579-40265601 GAAAAGAGAGAGAGGACTCCTGG + Exonic
1183897372 22:40980109-40980131 AAGAAGAGAAAGAAGAGTCCGGG - Intergenic
950652394 3:14415442-14415464 GAGAGCAGACAGAGGCCTCCAGG - Intronic
951002651 3:17581659-17581681 GAGATCATGTAGAAGATTCCAGG - Intronic
951031131 3:17882639-17882661 GAGACCAGCTTGAAGACTCTAGG + Intronic
953072132 3:39531261-39531283 GACAACACATAGAAGCATCCTGG - Intergenic
954791995 3:53140078-53140100 CAGATCAGTGAGAAGACTCCTGG - Intergenic
954901283 3:54022168-54022190 GAGAACAGAAGGAAGAGTCAGGG + Intergenic
955859330 3:63310830-63310852 GAAATCAGAAAGGAGACTCCTGG + Intronic
956282442 3:67571777-67571799 TAGAACAGATGTAGGACTCCTGG + Intronic
959253397 3:103977558-103977580 GAGAAAAGAGAGAAGACACAAGG - Intergenic
959859035 3:111195759-111195781 GAGAACAGATGGAAGGCACCAGG - Intronic
960316448 3:116184069-116184091 GAGAACAGAAAGTAGAATCTGGG + Intronic
961313928 3:126021475-126021497 TAGAACAGACAGAAGACACCTGG - Intronic
961938227 3:130608991-130609013 GAGAACATAAAGAAGAATCTGGG + Intronic
963560236 3:146855418-146855440 GAGAAGAGATGGGGGACTCCTGG - Intergenic
965790983 3:172387715-172387737 GAGGCCAGGTAGAGGACTCCTGG + Intronic
966160419 3:176961826-176961848 GACAGAAGATACAAGACTCCTGG + Intergenic
967158541 3:186715259-186715281 GGGAAGAGATACAACACTCCTGG + Intergenic
970484331 4:16509062-16509084 TAAAACAGAGAGAGGACTCCTGG + Intronic
970515709 4:16828076-16828098 GAGAGCAGATGGAAGCATCCTGG - Intronic
970878839 4:20904220-20904242 GAGATGAGATACAAGAATCCAGG + Intronic
970929700 4:21495327-21495349 CAGAACAGCTAGCAGATTCCTGG + Intronic
971802536 4:31310473-31310495 GAGAAGAGACAGATCACTCCAGG + Intergenic
973757213 4:54087149-54087171 AAGAACAAACAGAGGACTCCTGG + Intronic
973850515 4:54957060-54957082 GTGAACAGATATAACACTTCTGG - Intergenic
976577370 4:86689720-86689742 GAGAAAAACTAGAAGAGTCCAGG - Intronic
982355793 4:154466268-154466290 GAGAGAAGACAGAAGACTCCTGG + Intronic
982568226 4:157014371-157014393 GAGAACAAAAAGATGACTTCTGG - Intergenic
983287354 4:165756216-165756238 GAGAGCAGTTAGTAGACTCCTGG - Intergenic
988734800 5:34009462-34009484 GAAAACAGATAAAACACTTCAGG + Intronic
993417958 5:87658674-87658696 GAGAAAAGAGAAAAGACTCAGGG + Intergenic
995290947 5:110452668-110452690 GAGAAGAAATAGAAGAGTCAGGG + Intronic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
996098626 5:119425113-119425135 GAGACAAGATACCAGACTCCAGG + Intergenic
996864243 5:128101653-128101675 GAGAACAGAAACAAAACTTCTGG - Intronic
997597120 5:135114487-135114509 GACAACAGAGGGAAGGCTCCAGG + Intronic
997658660 5:135573859-135573881 GAGGACAGACATAAGACCCCAGG + Intronic
1002270612 5:178069508-178069530 GAAAACAGATTGAAGAGGCCAGG + Intergenic
1002946448 6:1765906-1765928 TAGGACAGAGAGAAGAGTCCTGG - Intronic
1003151706 6:3557958-3557980 GAAAACAGATTGATGACTTCTGG + Intergenic
1004184581 6:13411123-13411145 AAAAACAGAAGGAAGACTCCAGG + Intronic
1005384421 6:25271917-25271939 TACAACAGATAAAAGACTTCAGG + Intergenic
1008267875 6:49453680-49453702 GAGAGCTGGTAGAAGACTCTGGG - Exonic
1008878867 6:56360330-56360352 GAGAACAGATGCTAGACTCAGGG + Intronic
1009318492 6:62255242-62255264 TAGATCAGATAGAATTCTCCAGG - Intronic
1011145784 6:84214454-84214476 GACAATAGACAGAAGATTCCTGG - Intronic
1015519620 6:134117310-134117332 GATAATAGATAGCTGACTCCTGG - Intergenic
1015620721 6:135129149-135129171 GAGAATATCTAGAAGAATCCAGG + Intergenic
1018101156 6:160441643-160441665 GAGAACACACAGAAGTCTACTGG + Intronic
1018359728 6:163055010-163055032 GAGAACAGAAAGGAGATTCAAGG + Intronic
1019087836 6:169498788-169498810 GAGAACAGATAGCAGTTGCCAGG + Intronic
1022397740 7:30005740-30005762 AAAAACAGTTGGAAGACTCCGGG - Intergenic
1022443193 7:30450275-30450297 GAGTACAGAGAACAGACTCCAGG + Intronic
1022739177 7:33105159-33105181 GACAACAGATTGAAGAGTCTAGG + Intronic
1023637090 7:42223076-42223098 GAGAACACAGAAATGACTCCAGG + Intronic
1024899084 7:54296375-54296397 GAGAGAAGACAGAAGCCTCCTGG - Intergenic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1026497756 7:70918610-70918632 GCAAACAGATAAAAGAATCCGGG - Intergenic
1026774200 7:73220963-73220985 GGGAGCAGAAAGAGGACTCCTGG - Intergenic
1027015057 7:74774349-74774371 GGGAGCAGAAAGAGGACTCCTGG - Intronic
1027072974 7:75171604-75171626 GGGAGCAGAAAGAGGACTCCTGG + Intergenic
1027422739 7:78033247-78033269 GTGAACAAATACAAAACTCCGGG - Intronic
1027505460 7:79012366-79012388 CAGAGCAGAGAGAAGACTTCCGG - Intronic
1028347419 7:89799302-89799324 GGGAAAAGACATAAGACTCCTGG + Intergenic
1028492461 7:91427328-91427350 GAGCACTGATGGAAGACTGCTGG - Intergenic
1028571877 7:92298053-92298075 GAGAACAGAAAGAATACTGGAGG - Intronic
1028655708 7:93204096-93204118 GAGAACAGGAAAAAGACTCAAGG - Intronic
1028809405 7:95067343-95067365 TAAAACAGTCAGAAGACTCCAGG + Intronic
1029929509 7:104356205-104356227 AAGAACAGAACGCAGACTCCAGG + Intronic
1031187712 7:118503923-118503945 GAGAATAGAGAGAAGAATCAAGG + Intergenic
1031329428 7:120446114-120446136 GACAAAAGAGAAAAGACTCCAGG - Intronic
1031475096 7:122211627-122211649 GAGTAAACATAGAAGATTCCAGG + Intergenic
1031929455 7:127669584-127669606 AAGAACAAATATAAGACTCGTGG - Intronic
1032522348 7:132554983-132555005 GAGAGCAGATAGGAGACTCTTGG - Intronic
1033594300 7:142845027-142845049 GAAAATAGATAGAAGATACCAGG - Intergenic
1034322290 7:150197416-150197438 AAGAAGAGATACAAGACTACAGG - Intergenic
1034684704 7:152959742-152959764 GAGCACAAAAAGAAGACTCAAGG + Intergenic
1034770451 7:153769793-153769815 AAGAAGAGATAAAAGACTACAGG + Intergenic
1035749770 8:1988629-1988651 GAGACTAGCAAGAAGACTCCAGG - Intronic
1036539407 8:9689899-9689921 GACAACAGATAGAGGTCTTCTGG - Intronic
1036621760 8:10428643-10428665 GAGCACAGATAAAGGACTTCTGG - Exonic
1038515886 8:28187411-28187433 GAGAACAGAATGAAGGCTCCAGG - Intronic
1040105921 8:43541916-43541938 GAGAGCAGATAGAAGACCCAGGG - Intergenic
1044334790 8:90968234-90968256 GAGAACAGAATTAAGAGTCCAGG + Intronic
1046577619 8:116050820-116050842 AAGAAAAGATAGAAGCCTTCGGG + Intergenic
1047600938 8:126425398-126425420 AAGAACAGAAAGAAGATTCCAGG + Intergenic
1047835616 8:128687617-128687639 GAGAAAAGATACAAGGCTCCTGG + Intergenic
1049019244 8:139942702-139942724 GAGAACAGAGAACAGACACCCGG + Intronic
1050259151 9:3822951-3822973 AAGAACACATGGAAGACTTCTGG - Intergenic
1050449938 9:5769207-5769229 GAGAACTGATAGAAGAGGCTGGG - Exonic
1051343405 9:16131234-16131256 GAGACCAGAAAGAAGCCTCAGGG + Intergenic
1052209489 9:25885878-25885900 GAGAACAGTGAGGAGAGTCCTGG - Intergenic
1055281185 9:74676294-74676316 GAAAATAGATACAACACTCCTGG + Intronic
1057523683 9:95781111-95781133 GATTACAGAAAGAAGAGTCCTGG - Intergenic
1058238830 9:102529480-102529502 AAGGACAGATATTAGACTCCAGG + Intergenic
1059763776 9:117363852-117363874 GAGAAAAGATAGATGTCTGCCGG - Intronic
1061060463 9:128247635-128247657 GGGAACAGAGATAAGTCTCCTGG + Intronic
1061100134 9:128485841-128485863 GACAACAGAGAGAAGACACTCGG - Intronic
1062649591 9:137568730-137568752 GGGAACAGAAAGAAGCCTGCAGG + Intronic
1203633054 Un_KI270750v1:87297-87319 GAGAACACAAAGAAAACTCAAGG - Intergenic
1187018514 X:15354752-15354774 GAGAAAACAAAGAAGATTCCTGG - Intronic
1187418078 X:19110741-19110763 GAGGACAGAAAGAACATTCCAGG + Intronic
1192270831 X:69577815-69577837 GAAAACAGAGAAAAGAGTCCAGG - Intergenic
1192434143 X:71132351-71132373 GAGAACAGACAGAGGACACAGGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1195315816 X:103676777-103676799 AAGAACAAGCAGAAGACTCCTGG - Exonic
1195341275 X:103908583-103908605 AAGAAAAGAAAGAAAACTCCAGG + Intergenic
1195342861 X:103921760-103921782 GATAACAGATAGAAAGTTCCTGG - Intronic
1196515574 X:116606538-116606560 AAGAACAGCTAGAAGCCTCCAGG - Intergenic
1199323348 X:146467731-146467753 GTAAACATATAGAATACTCCTGG + Intergenic