ID: 916932703

View in Genome Browser
Species Human (GRCh38)
Location 1:169595784-169595806
Sequence GGATTGGTGTGGATTTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916932698_916932703 0 Left 916932698 1:169595761-169595783 CCTGTGACACATTACTTCTAATG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 916932703 1:169595784-169595806 GGATTGGTGTGGATTTCATAAGG 0: 1
1: 0
2: 1
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916932703 Original CRISPR GGATTGGTGTGGATTTCATA AGG Intronic
908680941 1:66660295-66660317 GCATAGGTGTGGACTTCATCTGG - Intronic
909085292 1:71163187-71163209 GGATTGGTGTGAAGTTTAAATGG + Intergenic
910167327 1:84341311-84341333 GGATTGGTAGAGATTTAATAAGG + Intronic
911097751 1:94069009-94069031 GGACTTGTGTGGACTTCAAATGG - Intronic
911460027 1:98177916-98177938 GGCTTGAGGTGGAATTCATAAGG - Intergenic
913015241 1:114726415-114726437 AGATTGGTGTGGAAGTGATATGG - Intronic
916876707 1:168977471-168977493 GGATTGGTGTGGACATCTTTGGG - Intergenic
916932703 1:169595784-169595806 GGATTGGTGTGGATTTCATAAGG + Intronic
917674601 1:177306877-177306899 GGATTGTGGTGGTCTTCATAAGG - Intergenic
918134731 1:181661450-181661472 GGTTTGGTGTGGAAATCAGAGGG + Intronic
921423556 1:214976543-214976565 GGATTGGAGAGGCTTTCAAAAGG - Intergenic
1065481245 10:26195873-26195895 GGATTGGTGTGGCTTCCACGAGG + Intronic
1069125068 10:64620147-64620169 GTCTTGGTGTGGATTTCTTTGGG - Intergenic
1074424822 10:113341800-113341822 GCAGTAGTGTTGATTTCATAGGG + Intergenic
1078769655 11:14336908-14336930 GTCTTGGTGTAGATTTCATTGGG - Intronic
1082991746 11:59212603-59212625 GGAATGGTGAAGATTTCATCAGG + Exonic
1085067427 11:73510079-73510101 GGATTGGTATGATTTTCATGGGG - Intronic
1088640466 11:111868162-111868184 GTCTTGGTGTGGATTTCTTTGGG - Intronic
1090311056 11:125740662-125740684 GGTTTGGTGTTGATTGCAAAGGG - Intergenic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1093000328 12:13988857-13988879 GAATTAGGGTGGATTTCATTAGG + Intergenic
1093251101 12:16805571-16805593 GGTTTGGTTTGGTTTTCAGACGG - Intergenic
1094162941 12:27410963-27410985 GAAAATGTGTGGATTTCATACGG + Intronic
1094392538 12:29967245-29967267 GGATTGGTCTGTATGTCATGAGG - Intergenic
1095095318 12:38144682-38144704 GGATGGGAGTGGATTTCAGGAGG - Intergenic
1096722748 12:53536101-53536123 GGAATGGTGTGGATTGGAAAGGG - Intronic
1096875365 12:54625941-54625963 GGGTTGGTAGGGATTTCATCAGG + Intergenic
1101544607 12:105700268-105700290 GGAATGCTGTGTACTTCATATGG - Intergenic
1104561168 12:129846051-129846073 GGACTGGTGGGCATTTCTTATGG + Intronic
1104776746 12:131393822-131393844 GGGTTGGTGTGGGTGTGATATGG + Intergenic
1109194193 13:59359987-59360009 GGATTGTTGTTTATTTTATAGGG + Intergenic
1109833652 13:67826907-67826929 GCGTTGGTGTGGATTTCTTTAGG + Intergenic
1110406418 13:75155608-75155630 AGATTTGTGTGGGATTCATAAGG - Intergenic
1111330570 13:86759099-86759121 GGCTTGGTGTGGTTAGCATAGGG + Intergenic
1111841115 13:93452760-93452782 GCATTGGTGTATATTACATATGG + Intronic
1111841122 13:93452845-93452867 GCATTGGTGTATATTACATATGG + Intronic
1112950023 13:104982729-104982751 GAATTTGTGTTGCTTTCATAGGG + Intergenic
1113972954 13:114204187-114204209 GGCTTGCTGGGGATTTTATAGGG + Intergenic
1116064558 14:39966424-39966446 TGATTGGTGTGGGGTTCAGAGGG + Intergenic
1122289363 14:100671745-100671767 GGGTTGCTGTGGATTTCTCATGG - Intergenic
1124454756 15:29831604-29831626 GGACTGCTGTGGATTTTATGTGG + Intronic
1126817666 15:52470290-52470312 GCTTTGGTGTTGAATTCATAGGG + Intronic
1141124369 16:81389928-81389950 AGATTGGTGTGGTATTTATATGG - Exonic
1146439191 17:32878494-32878516 GGATTGGGGTGGTTTTCTGATGG - Intergenic
1146467179 17:33095577-33095599 GGATCTGTGTGGATCTCACAGGG + Intronic
1149077307 17:52611327-52611349 GCATGGCTGTGGATTTCTTAAGG + Intergenic
1150403374 17:64877757-64877779 TGATTGCTGTGGATTTGATTTGG - Intronic
1154130749 18:11735013-11735035 GGATTGGTGGGCATTTGATAAGG + Intronic
1155870983 18:31027894-31027916 GCATTGGAGTGTGTTTCATAAGG - Intronic
1156341741 18:36215567-36215589 GGATCTGTGAGGATTTCATTTGG + Exonic
1156590662 18:38484235-38484257 TGATTCGTGTGGATTTCACATGG + Intergenic
1157183927 18:45522143-45522165 GGGTTACTGTGGATTTCAAATGG + Intronic
1158020153 18:52832225-52832247 GGTTGGATGTGGGTTTCATAGGG + Intronic
1162160911 19:8715593-8715615 GTCTTGGTGTGGATTTCTTTGGG + Intergenic
1167596431 19:50430783-50430805 GGAGTGGGGTGGATTTCAGGCGG - Exonic
925800009 2:7589747-7589769 GCATCGGTGTGGATTTGACAGGG + Intergenic
927079638 2:19614747-19614769 GTCTTGGTGTGGATTTCTTTTGG - Intergenic
929863499 2:45698795-45698817 GGAGTTGTCTGGATTTCCTAGGG + Intronic
930740893 2:54831664-54831686 GGATTGGTGTGCATCTTAGATGG + Intronic
931951366 2:67366352-67366374 GGATTGTTGTGTTTTTCTTAAGG - Intergenic
932092395 2:68817938-68817960 TGATTGGTGTGAATCTCATCAGG + Exonic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
935526351 2:104172615-104172637 GTCTTGGTGTGGATTTCCTTGGG - Intergenic
936688821 2:114861319-114861341 GGTTTGGTGTGGTTGTCATGTGG - Intronic
937979548 2:127606906-127606928 GAATTGGTGTGGATTTCACATGG - Intronic
938419999 2:131137818-131137840 GTATTTGTGTGGATTTCTTTGGG + Intronic
939465418 2:142548351-142548373 GTCTTGGTGTGGATTTCTTTGGG - Intergenic
943594371 2:189838199-189838221 AGATTGGTTTGGATTTCCTTAGG + Intronic
946985961 2:225273690-225273712 TTATTTGTGTGGCTTTCATAGGG - Intergenic
1172219103 20:33260301-33260323 GGATTCATGTGGCTTTGATAGGG + Intergenic
1175463760 20:59175192-59175214 GCTTTGGTGTGGATTTCTTTGGG + Intergenic
1176365188 21:6028520-6028542 GGCTTGCTGGGGATTTTATAGGG - Intergenic
1178447127 21:32655753-32655775 GCATGTGTTTGGATTTCATAGGG - Intronic
1179126410 21:38595088-38595110 GGGTTTGTGTGGATCTCAAAGGG + Intronic
1179610818 21:42548747-42548769 GGACTGGTGAGGATTTCACACGG - Intronic
1179758330 21:43510025-43510047 GGCTTGCTGGGGATTTTATAGGG + Intergenic
1185297345 22:50060925-50060947 GGACTGGTGTGGATTTCACCTGG + Exonic
952257273 3:31706286-31706308 GGATGGGGGTGGATATCTTAAGG - Intronic
952912091 3:38199767-38199789 GGAGTGGAGTGGATTTCCTTGGG + Intronic
953109829 3:39923367-39923389 GTCTTGGTGTGGATTTCTTTGGG - Intronic
953832204 3:46309719-46309741 GTCTTGGTGTGGATTTCTTTGGG + Intergenic
961444841 3:126975080-126975102 GTCTTGGTGTGGATTTCCTTGGG + Intergenic
961485766 3:127214807-127214829 GTCTTGGTGTGGATTTCTTTGGG - Intergenic
962098611 3:132317860-132317882 GGACTGGTGTGGCTGTCAAAAGG - Intronic
962981022 3:140490214-140490236 TGACCGGTGTGGATTCCATATGG - Intronic
969488003 4:7482895-7482917 TGAGTGGTGTGAATTTCAGAGGG - Intronic
977035293 4:91943606-91943628 GAATTTATTTGGATTTCATACGG + Intergenic
978750233 4:112237830-112237852 GGCTTGGAGCGGGTTTCATAGGG - Intronic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
983371048 4:166858283-166858305 TTATTGCTGTGAATTTCATAGGG + Intronic
984460011 4:180022543-180022565 GTCTTGGTGTGGATTTCTTTGGG - Intergenic
985024442 4:185726234-185726256 GGATTTATGTGGTTTTCATAGGG - Intronic
985960564 5:3299899-3299921 GGATTGGTTTGGATTTGATTTGG - Intergenic
986331962 5:6723781-6723803 GGAGTGTTGAGGATTTCATAGGG + Intronic
986787225 5:11125485-11125507 GGAATGGTGTGGACATCACAGGG + Intronic
988458712 5:31412850-31412872 TTTTTGGTTTGGATTTCATATGG + Intronic
994110300 5:95995574-95995596 GGATTGCTATTGATTTCAGAAGG + Intergenic
1001253193 5:170164348-170164370 GGCTGGGTGAGGATTTCCTAAGG + Intergenic
1003691165 6:8355029-8355051 GGATGGGTTTGGAGTTCAGAAGG + Intergenic
1007803658 6:44420241-44420263 GAATTTGTGTGGTTTTCAGAAGG - Intronic
1008203041 6:48616083-48616105 GGATTTGTGTGGTTTTGAAAGGG - Intergenic
1008409005 6:51151122-51151144 GGATTGCTGAGGATCTCACATGG - Intergenic
1012428325 6:99138707-99138729 GGGGTGGGGTGGATTTCAGATGG + Intergenic
1013239220 6:108228050-108228072 TGATTGGTGTATGTTTCATAAGG - Intronic
1017837266 6:158189789-158189811 TGACTGGAGTGGGTTTCATATGG - Intronic
1020737456 7:11968989-11969011 GTTTTGATGTGGATTTCAGAAGG + Intergenic
1021465582 7:20939187-20939209 GGATTGTTGTGGAGTTTAAATGG + Intergenic
1021936925 7:25640237-25640259 GGATTGTTGTTGCTTTCATGGGG - Intergenic
1022269354 7:28791047-28791069 GATTTGGTGTGGATTTGATGTGG - Intronic
1027753225 7:82178515-82178537 GGATTGGAGGGGTTTTCATGGGG - Intronic
1027814443 7:82951218-82951240 GGATTTGTCTGGTATTCATACGG - Exonic
1029932636 7:104389118-104389140 GTATGTGTGTGGATTTCTTAGGG - Intronic
1033197583 7:139341019-139341041 GTGTGGGTGTGGATTTGATATGG - Intronic
1034285070 7:149878986-149879008 GGTTTGGTTTTGATTTCATTTGG + Intronic
1046798603 8:118399332-118399354 TGATTGGTATGGACTTCATGTGG + Intronic
1053122503 9:35557465-35557487 GGAGGGGTGTCGATTTCACATGG + Intronic
1053458660 9:38251376-38251398 GAATTGCTGTGGAGTTCTTATGG - Intergenic
1055123450 9:72690787-72690809 GTATTGGTGTGGATTTATTTGGG + Intronic
1056401062 9:86227681-86227703 TGATCGGTGAGAATTTCATAAGG + Intronic
1057278372 9:93689894-93689916 TGGTTGGTGTGGATTTCTTTAGG - Intergenic
1058117500 9:101101018-101101040 GAATGGGTGTGCATTTCTTAAGG - Intronic
1058938106 9:109787890-109787912 TGATTTATTTGGATTTCATAAGG + Intronic
1060150353 9:121284448-121284470 GGATTAGAGTGGATCTCAGAGGG - Intronic
1060468811 9:123930424-123930446 GGATTGGTGGCGGTTTCATCGGG - Intergenic
1062324492 9:136005588-136005610 GGATGGATGTGGTTTCCATATGG - Intergenic
1185706282 X:2269378-2269400 GTATTTGTGTGTATTTTATATGG + Intronic
1187042814 X:15614921-15614943 GGTTTTGTGAGGATTTAATAAGG - Intergenic
1187284260 X:17887947-17887969 GACTTGGTGTGGATTTCTTTGGG - Intergenic
1187380077 X:18793941-18793963 GGGCTGGTGTGGATTTAATTGGG + Intronic
1190683561 X:52850822-52850844 GGATTGGTCTGGGTATCATTTGG + Intergenic
1191176668 X:57510112-57510134 GGATTGGATTGGCTTTAATAAGG + Intergenic
1192704038 X:73509977-73509999 GTCTTGGTGTGGATTTCTTTGGG + Intergenic
1193591674 X:83395998-83396020 GGATGGGTGTGTATTTGATCTGG - Intergenic
1193730460 X:85096572-85096594 GTCTTGGTGTGGATTTCTTTGGG - Intronic
1197342467 X:125289335-125289357 TGATTTGTTTTGATTTCATAGGG + Intergenic
1199077850 X:143544882-143544904 GGATTGGTGTTGAGTTCCTGTGG + Intergenic
1199272343 X:145898843-145898865 GGCTTGGTGTGGATCTCTGACGG - Intergenic
1201108703 Y:10782979-10783001 GGAGTCGAGTGGAGTTCATAGGG - Intergenic
1201184738 Y:11389279-11389301 GGACAGGGGTGGATTTGATATGG + Intergenic