ID: 916933578

View in Genome Browser
Species Human (GRCh38)
Location 1:169604832-169604854
Sequence CAGCAGGGGTAGATGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916933566_916933578 20 Left 916933566 1:169604789-169604811 CCACAGAACCCATTTCCAGCTCT 0: 1
1: 0
2: 2
3: 37
4: 314
Right 916933578 1:169604832-169604854 CAGCAGGGGTAGATGTGGAGGGG 0: 1
1: 0
2: 3
3: 36
4: 337
916933568_916933578 12 Left 916933568 1:169604797-169604819 CCCATTTCCAGCTCTTCTGTGGC 0: 1
1: 0
2: 1
3: 23
4: 253
Right 916933578 1:169604832-169604854 CAGCAGGGGTAGATGTGGAGGGG 0: 1
1: 0
2: 3
3: 36
4: 337
916933570_916933578 5 Left 916933570 1:169604804-169604826 CCAGCTCTTCTGTGGCTTTGCCT 0: 1
1: 1
2: 5
3: 44
4: 370
Right 916933578 1:169604832-169604854 CAGCAGGGGTAGATGTGGAGGGG 0: 1
1: 0
2: 3
3: 36
4: 337
916933569_916933578 11 Left 916933569 1:169604798-169604820 CCATTTCCAGCTCTTCTGTGGCT 0: 1
1: 1
2: 2
3: 43
4: 446
Right 916933578 1:169604832-169604854 CAGCAGGGGTAGATGTGGAGGGG 0: 1
1: 0
2: 3
3: 36
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916933578 Original CRISPR CAGCAGGGGTAGATGTGGAG GGG Intronic
900365763 1:2311353-2311375 CAGCAGGAGTGGGTGTGGACTGG + Intergenic
900519024 1:3096717-3096739 GAGCAGGGGTGGATGGTGAGTGG + Intronic
900611938 1:3547975-3547997 CAGCAGGGGTGGGTGGGCAGAGG - Intronic
901324910 1:8360329-8360351 CCGGTGGGGTAGAGGTGGAGGGG + Exonic
901573117 1:10178001-10178023 CAGGAAGGGAAGTTGTGGAGTGG - Intronic
902786884 1:18738609-18738631 CAGCAGGGGTGGAGCTGGAAGGG - Intronic
903085219 1:20851298-20851320 CAGGAGGTGTGGATGTGGAGAGG - Exonic
904333778 1:29784283-29784305 CAGCAGGGGGAGAAGGTGAGAGG + Intergenic
904818986 1:33228198-33228220 GAGCAGGAGCAGGTGTGGAGGGG - Intergenic
904825977 1:33274039-33274061 CCACAGGGGGAAATGTGGAGGGG - Intronic
904916968 1:33977210-33977232 CAGCAGGGCTGGGTGGGGAGTGG + Intronic
905418845 1:37825025-37825047 CTGTAGGGGTAGAGGTGGATTGG - Intronic
906243922 1:44259956-44259978 AAGGAGGGGTAGATGTGCAAAGG - Intronic
907601717 1:55777981-55778003 CAGCAGGGGTAAATACAGAGAGG - Intergenic
907987114 1:59542986-59543008 GAGCAGGTGCAGAGGTGGAGAGG + Intronic
909235502 1:73148323-73148345 CAGCAGGGTAAGAAGTGGAAAGG - Intergenic
910413150 1:86967444-86967466 CAGTAGGGGGAGAAGGGGAGGGG - Intronic
910704085 1:90107941-90107963 CAGAAGGTGTAGATGTGTATGGG + Intergenic
910777688 1:90892511-90892533 CATCAGAGGGAGACGTGGAGAGG + Intergenic
912944609 1:114074757-114074779 CAGCAGGGCTAGTTATGGGGTGG - Intergenic
913960052 1:143332572-143332594 CAGCAGTGGTAGTTGTGTGGTGG + Intergenic
915928893 1:160046078-160046100 GTGCAGGGGTAGAAGTGGGGTGG - Intronic
916246831 1:162696719-162696741 CAGCAAGGGTATGGGTGGAGAGG - Intronic
916933578 1:169604832-169604854 CAGCAGGGGTAGATGTGGAGGGG + Intronic
920344631 1:205298395-205298417 GAGCAGGGGGAGAGGTGAAGGGG + Intergenic
920347308 1:205314476-205314498 GGCCAGGGGTAGATGTAGAGAGG + Intronic
923544654 1:234915263-234915285 CAGCAGGGTGAGTTGTGGGGAGG - Intergenic
923777178 1:236990239-236990261 CAGAAGGGGAAGATGTGGGTAGG - Intergenic
1065359388 10:24875391-24875413 CAGCAGGGGAGAATGGGGAGAGG - Intronic
1066292995 10:34030776-34030798 CAGCAGGGCTAGATGCAGACGGG - Intergenic
1066433945 10:35379377-35379399 CAGAAGGGGAAGGTGGGGAGCGG + Intronic
1069601375 10:69710338-69710360 CACCTGGGGTAGATAGGGAGTGG - Intergenic
1069876315 10:71565346-71565368 CTGCTGGGGTAGAGCTGGAGGGG + Intronic
1070810688 10:79296360-79296382 CAGCAGGAGCAAATGAGGAGAGG + Intronic
1072017317 10:91361187-91361209 CAGCAAGGGTGAATGTGAAGTGG - Intergenic
1072711301 10:97717322-97717344 CAGTAGGGGGAGATGGGGAGAGG + Exonic
1073133645 10:101207088-101207110 CAGCAGGGGAAGATGGTGGGTGG + Intergenic
1073205244 10:101765773-101765795 CAGGATGGGCAGATTTGGAGGGG - Intergenic
1073217202 10:101843287-101843309 CAGAAGAGGCAGGTGTGGAGAGG - Intronic
1074776252 10:116770343-116770365 CCGAAGGGGCAGATGTGGGGAGG + Intergenic
1076329096 10:129652086-129652108 GTGTAGGAGTAGATGTGGAGGGG + Intronic
1077329898 11:1979639-1979661 GATCAGGGGAGGATGTGGAGCGG + Intronic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078097909 11:8311770-8311792 CAGCAGGGCTTGGTTTGGAGAGG - Intergenic
1078203724 11:9209482-9209504 AAGAAGGGGCAGATGTGGAGAGG - Intronic
1078521551 11:12067955-12067977 CAGCAGGGAAAAATGAGGAGGGG - Intergenic
1079768387 11:24424963-24424985 CTGCTTGGTTAGATGTGGAGGGG + Intergenic
1080721947 11:34858191-34858213 TTGAAGGGGTAGAAGTGGAGGGG - Intronic
1081806900 11:45895913-45895935 CAGCTGGGGTGGAAGTGGGGAGG - Intronic
1083500422 11:63101938-63101960 AAGAAAGGGTAGTTGTGGAGGGG + Intronic
1084148185 11:67275947-67275969 CCTCAGGGGTAGATGTGCAGCGG + Intronic
1084167672 11:67383579-67383601 CTGCAGGGCTGGAGGTGGAGGGG - Intronic
1084734202 11:71093987-71094009 CAGCAGGGGAAGGTGAGGCGCGG + Intronic
1084780519 11:71405201-71405223 TAGCTGGGGTGGATTTGGAGGGG + Intergenic
1085118215 11:73949243-73949265 CAGCAGAGGTGAATGAGGAGAGG + Intergenic
1085451925 11:76639341-76639363 CTTCAGGGGTAGAGCTGGAGAGG - Intergenic
1087092363 11:94286586-94286608 AAGCAGGGGAACATGTGGACAGG + Intergenic
1087114114 11:94505337-94505359 CAGCAGGACAAGATGTGGAGGGG + Intergenic
1087333916 11:96818635-96818657 CAGAAGGAGAGGATGTGGAGAGG + Intergenic
1089291465 11:117439960-117439982 GTGCAGGGGTAGAAGTGGAGTGG - Intronic
1202812876 11_KI270721v1_random:34818-34840 GATCAGGGGAGGATGTGGAGCGG + Intergenic
1091635571 12:2194175-2194197 CAGGAGGGGAAGAAGAGGAGAGG - Intronic
1092050149 12:5463502-5463524 CAGCAGGGTTATAGGTGGACAGG + Intronic
1092169085 12:6362179-6362201 CATCAGGGGTGGATGCGGTGAGG - Exonic
1092539076 12:9408575-9408597 CAGGAGGGGAAGATGGGGAGAGG - Intergenic
1092556661 12:9567916-9567938 CAGGAGGGGAAGAGGGGGAGAGG + Intergenic
1094515303 12:31122407-31122429 CAGGAGGGGAAGAGGGGGAGAGG - Intergenic
1094515741 12:31124285-31124307 CAGGAGGGGAAGAGGGGGAGAGG - Intergenic
1097734323 12:63165407-63165429 CAGTGGGGGAAGATCTGGAGAGG - Intergenic
1098901368 12:76115128-76115150 TTCCAGGGGTAGATGTGGAGTGG - Intergenic
1100138039 12:91579236-91579258 CAGGAGGGGTGGAGGTGGTGGGG - Intergenic
1100144467 12:91660515-91660537 CAACAGAGGTAGATGAGGGGAGG + Intergenic
1101618787 12:106363327-106363349 TAGCAGGTTTAGGTGTGGAGGGG - Intronic
1101941920 12:109105776-109105798 AGGCAGGGGTAGATTTGGAGGGG - Intronic
1102564059 12:113783116-113783138 CTGCAGGAGGAGAAGTGGAGAGG - Intergenic
1104598304 12:130134673-130134695 CAGCAGGGATAGCTGGGTAGTGG - Intergenic
1104678066 12:130729272-130729294 CAGCAGGGGTGGGTGTGACGGGG + Intergenic
1106539604 13:30678179-30678201 TAGCAGGGGTGGGGGTGGAGGGG + Intergenic
1107213372 13:37885930-37885952 GAGAAAGGGCAGATGTGGAGCGG - Intergenic
1107597461 13:41977699-41977721 CTGCTGGGGTAGATGGGGAGGGG - Intergenic
1107976138 13:45690442-45690464 CAGGATGGGGGGATGTGGAGGGG + Intergenic
1108038830 13:46320666-46320688 CTGCAGGGGTGTGTGTGGAGAGG - Intergenic
1108834318 13:54522257-54522279 CAGCAGGGGAAGCTGTTAAGAGG - Intergenic
1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG + Intergenic
1112483991 13:99803159-99803181 CACCAGTGACAGATGTGGAGTGG + Intronic
1112551260 13:100423216-100423238 CTGAAGGGGCAGATGTGGAGTGG - Intronic
1113535526 13:111063298-111063320 CAGCAAAGGGAGATGGGGAGGGG - Intergenic
1113583315 13:111444685-111444707 TGGCAGGGGCTGATGTGGAGGGG - Intergenic
1113644038 13:111979883-111979905 CAGCAGGGGGACATGAGGGGAGG + Intergenic
1113997074 14:16097441-16097463 CAGAATGTGGAGATGTGGAGTGG - Intergenic
1113997342 14:16099224-16099246 CAGAATGTGTTGATGTGGAGTGG - Intergenic
1114398855 14:22391132-22391154 AAGCAGGGGAAGATTTGGGGTGG + Intergenic
1118931647 14:70247492-70247514 CAGCAGGGGCAGAAGTGCAAAGG - Intergenic
1118953517 14:70457646-70457668 CAGCAGGGGCAGAAGTGCAAAGG + Exonic
1118960370 14:70524589-70524611 CAGCAGGGGCAGAGGTGCAAAGG - Exonic
1119382869 14:74239924-74239946 CAGCTCGGGTAGGTGAGGAGAGG + Exonic
1119679911 14:76584601-76584623 CAGAGGGGGAAGAGGTGGAGGGG + Intergenic
1120410749 14:84152506-84152528 CAGCAGGGGCCCATCTGGAGTGG + Intergenic
1120590629 14:86369798-86369820 CAGCATGGGTAAGTGTGGGGAGG + Intergenic
1121013256 14:90534090-90534112 CAGCAGGTGCAGAGCTGGAGTGG + Exonic
1121216846 14:92255025-92255047 CAGCAGCCGTAGCTATGGAGCGG - Intergenic
1121413550 14:93763636-93763658 CAGTGGGGGTGGATGTGGGGTGG + Intronic
1121700684 14:95951810-95951832 GAGCTGTGGTAGAGGTGGAGGGG + Intergenic
1121836273 14:97095453-97095475 CAGCAGGTGGAGACGAGGAGGGG - Intergenic
1122207405 14:100154881-100154903 CAGGAGGGGCAGGGGTGGAGTGG - Intronic
1122388354 14:101364099-101364121 CAGCAGGGGTGGGGGTGGGGAGG - Intergenic
1124257216 15:28153957-28153979 CAGCAGGGGCAGCTGTGTTGGGG - Intronic
1124846997 15:33301002-33301024 CTGCAGGGAGAGATGTGGATGGG - Intergenic
1125726972 15:41873145-41873167 CACCTGTGGGAGATGTGGAGCGG + Intronic
1126916071 15:53467673-53467695 GCACACGGGTAGATGTGGAGGGG - Intergenic
1127571160 15:60243136-60243158 CACCAGGGCTAGTTGTGGGGTGG + Intergenic
1127836598 15:62795545-62795567 CAGGAGTGTTAGAAGTGGAGAGG + Intronic
1128489861 15:68134906-68134928 CAGCAGGGGTGGCTGGGCAGAGG + Intronic
1128490098 15:68135430-68135452 CAGCAGGGGTGGCTGGGCAGAGG + Intronic
1130632186 15:85580606-85580628 CAGCAGTGGAGGATGTGGACAGG - Exonic
1132144973 15:99424337-99424359 GGGCAGGGGTGGAGGTGGAGGGG + Intergenic
1133754474 16:8752122-8752144 GAGCAGGGGAAGAAGAGGAGGGG - Intronic
1134196614 16:12163859-12163881 GAGCAGGTGTAGGTGAGGAGAGG + Intronic
1136088555 16:27902633-27902655 CAGCAGGGAGGGATGGGGAGGGG + Intronic
1136552810 16:30990458-30990480 GAGCTCGGGTAGAGGTGGAGGGG + Exonic
1137402812 16:48167138-48167160 AAGCAGGGGTAAATGTAGGGGGG - Exonic
1138609510 16:58111480-58111502 CAGGAGGTGGAGAAGTGGAGGGG - Intergenic
1141848798 16:86630020-86630042 CAGAAGGGGTTGTTGGGGAGAGG + Intergenic
1142349522 16:89573702-89573724 CTGGAGGGTTAGATGTGGGGAGG + Intergenic
1143450929 17:7036297-7036319 CAGCGGGGGTGGGTGTGCAGAGG + Exonic
1144093635 17:11880631-11880653 AAGCAGGGGGTGGTGTGGAGAGG + Intronic
1145761095 17:27425820-27425842 CAGAAGGGGAAGATGTTGGGGGG + Intergenic
1145768760 17:27477667-27477689 CATCTGGCGTAGAAGTGGAGGGG - Intronic
1145977906 17:28994809-28994831 GGGCAGGGGTAGAGGAGGAGGGG + Intronic
1146456899 17:33015652-33015674 CAGCAGGGGGAGAACTGGACAGG - Intronic
1146724629 17:35147500-35147522 TATCTGGGATAGATGTGGAGAGG + Intergenic
1146938543 17:36827345-36827367 GAGCAGGGGAAGGGGTGGAGAGG - Intergenic
1147315869 17:39619980-39620002 CAGCAGGGGCAGAGATGGGGAGG - Intergenic
1147703106 17:42408253-42408275 CAGCAGGGGTAGGGGAGAAGCGG - Intronic
1147739257 17:42661060-42661082 CAGCATGGGGAGAGATGGAGAGG - Intronic
1148544070 17:48503622-48503644 CAGCAGGGCTGGATGGGGTGAGG - Intergenic
1148785824 17:50145774-50145796 CAGGAGGGGTGGAAGGGGAGAGG + Intronic
1149356287 17:55843392-55843414 CTGGAGAGGTAGATGGGGAGGGG - Intergenic
1150991557 17:70265534-70265556 TAGCAGAGGAAGATGTTGAGAGG - Intergenic
1151149876 17:72076027-72076049 CAGCAGGGGATGGTGTGGGGAGG - Intergenic
1152120318 17:78414452-78414474 CAGCAGGTCTGGATGTGCAGAGG + Intronic
1153056273 18:949620-949642 CAGCAGTGGTGGATGGGGTGGGG + Intergenic
1153434055 18:5049414-5049436 AACCAGGGGTAGAAGAGGAGGGG + Intergenic
1153988297 18:10372734-10372756 CAGCTTGGTTAGATGTTGAGGGG - Intergenic
1154192365 18:12241406-12241428 GAGGAGGGGGAGATGGGGAGTGG - Intergenic
1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG + Intergenic
1157433378 18:47649406-47649428 GGGCAGGGGAAGATATGGAGGGG + Intergenic
1157568389 18:48696092-48696114 CAGCTGGGGAAGAAGTGGAGAGG - Intronic
1158317461 18:56227483-56227505 CAGCAAGGCTAGATGTGGGCTGG - Intergenic
1158409951 18:57196920-57196942 AAGCAGGGAAAGATGTGGTGTGG - Intergenic
1158944316 18:62435432-62435454 CAGCACGGAGAAATGTGGAGAGG - Intergenic
1158988762 18:62847266-62847288 CAGCAAGGAGAGATGGGGAGAGG + Intronic
1159680784 18:71349145-71349167 CAGCATGGTCAGATCTGGAGAGG - Intergenic
1161062473 19:2222117-2222139 CAGCAGGGGGTGCTGTGGCGTGG - Exonic
1161102898 19:2430130-2430152 CAGGGAGGGGAGATGTGGAGGGG - Exonic
1161269637 19:3382737-3382759 CAGCATGTGTAGATGTGATGTGG + Intronic
1161414756 19:4139731-4139753 GAGGAGGGGAAGATGGGGAGGGG + Intergenic
1161663235 19:5560015-5560037 CACCAAGGGGAGAGGTGGAGGGG + Intergenic
1162918324 19:13885946-13885968 CAGCCGAGGTAGGTGTGGCGTGG - Exonic
1163541960 19:17916849-17916871 CAGCTGGGGCAGAGGAGGAGAGG + Intergenic
1164597178 19:29537906-29537928 CAGCATGGGCAGCTGTGGGGAGG - Intronic
1165072523 19:33263847-33263869 CGGCAGGGGAAGACGTGGACAGG - Intergenic
1165278383 19:34774281-34774303 CTGGAGGGGCAGATGGGGAGGGG - Intergenic
1167615485 19:50530561-50530583 CTGCAGGTGCAGAGGTGGAGAGG + Intronic
1168575380 19:57504577-57504599 GAGCAGGGGTGGATGTTTAGGGG + Intronic
1168630360 19:57951089-57951111 CAGCAGTGGCTGATCTGGAGGGG - Intergenic
1168714299 19:58518158-58518180 CAGCAGGGGTGGAGGAGGAGTGG - Intronic
925380116 2:3418938-3418960 GAGCAGGTGTGGATGAGGAGAGG - Intronic
925883535 2:8372883-8372905 CAGCAGGGAGAGGTGGGGAGTGG + Intergenic
926121930 2:10245943-10245965 CGGCAGTGGTAGGTTTGGAGAGG + Intergenic
926191831 2:10734231-10734253 CAGCAGGGGCAGATGGGAGGAGG - Intronic
927374581 2:22398992-22399014 CAGAAGAGGTAGATGTAGACAGG - Intergenic
927639176 2:24836018-24836040 CAGAAGGGGAAGATGTGGCTGGG - Intronic
928122201 2:28591430-28591452 AAGCAGGGGCAGGTGTGGAGTGG + Intronic
928270359 2:29849792-29849814 AAGCAGGGGAAGAAGGGGAGAGG + Intronic
928771515 2:34707451-34707473 CAGAAGGGAGAGATGTGGAAAGG + Intergenic
929299651 2:40288496-40288518 CAGCTGAGGTAGAAGTGGAGGGG - Intronic
931245285 2:60487373-60487395 CAGCAGGGGGAGCAGTGTAGTGG + Intronic
932264754 2:70358050-70358072 CAGGAGGAATAGATGTGGGGCGG + Intergenic
932949898 2:76280836-76280858 CAGCAGTGATATATGTGCAGAGG - Intergenic
933720874 2:85396787-85396809 CAGCAGGGATAGAAGTGAAAGGG - Intronic
933904481 2:86876666-86876688 AAGCAGAGGGAGATGTGGAAGGG + Intergenic
934503374 2:94875179-94875201 CAGCAGGAGGAGCTGTGGGGAGG + Intronic
935558643 2:104538186-104538208 CAGGAGGGGTGGAAGTGGGGAGG + Intergenic
935871207 2:107451964-107451986 CTGCTGGGATAGAGGTGGAGGGG + Intergenic
936046484 2:109191994-109192016 CTGCAGGGGTTGAGGTGGAGGGG - Intronic
936264927 2:110996780-110996802 CAGCAGGGGTAGAAGGGAAGAGG + Intronic
936367758 2:111875485-111875507 AAGCAGAGGGAGATGTGGAAGGG - Intronic
936609117 2:113984296-113984318 CAGCAGGGGGAGTGGTGCAGAGG + Intergenic
937064686 2:119009042-119009064 TGGAAGGGGTAGGTGTGGAGTGG - Intergenic
937954918 2:127416773-127416795 TAGGAGGGGTGGAGGTGGAGAGG - Intergenic
938084376 2:128389146-128389168 CAGCAGGGGTGGGTTTGGTGAGG + Intergenic
938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG + Intergenic
938377582 2:130818950-130818972 TAGCACGGGAGGATGTGGAGAGG + Intergenic
938828961 2:135033637-135033659 CAGCAGGGGTGGCTGGGCAGAGG + Intronic
940019098 2:149138433-149138455 AAGCAGGTGCAGATGTGGATGGG + Intronic
942469348 2:176243531-176243553 CAGCAGGGAGAGCTGGGGAGGGG - Intergenic
944349018 2:198704915-198704937 CAGTAGGGCTAAAGGTGGAGAGG + Intergenic
944555254 2:200882058-200882080 CAGCAGGGCTAGTTGTGGGTGGG + Intronic
944755845 2:202760903-202760925 CAGCAGGGCTGGCAGTGGAGGGG - Intronic
945569409 2:211446185-211446207 CAGCAGGTGTCCATGTAGAGTGG + Intronic
946037498 2:216755592-216755614 CAGCAGGGGTTGAGGAGGAGAGG + Intergenic
946776104 2:223142851-223142873 GAGCAGGGTGAGATGGGGAGTGG - Intronic
946804515 2:223457883-223457905 AAGAAGGGGTAGCCGTGGAGAGG + Intergenic
947107047 2:226678562-226678584 CAGCGTGTGTAGATATGGAGAGG - Intergenic
947453060 2:230225860-230225882 CAGCAGGGGCAGATGGCAAGTGG + Exonic
948076477 2:235168709-235168731 CAGCAGGGCCAGATGGGGAAGGG + Intergenic
948361240 2:237422016-237422038 CAGCAGGCGCAGAAGTGGAGGGG + Intronic
948476897 2:238226364-238226386 CAACAGGGCTGGGTGTGGAGTGG + Intronic
1168806388 20:674763-674785 CAGCAGGGTTGGTTCTGGAGGGG + Intronic
1169598291 20:7226208-7226230 CAGCTGAGGTAGATATGGTGGGG + Intergenic
1172093762 20:32450831-32450853 CAGCACGGTGAGAGGTGGAGTGG - Intronic
1173021729 20:39273178-39273200 CAGGCAGCGTAGATGTGGAGGGG - Intergenic
1173836713 20:46130627-46130649 GGGCAAGGGGAGATGTGGAGAGG + Intergenic
1173853314 20:46232741-46232763 CAGCAGGGGTGGATGTTGAGAGG - Intronic
1178979235 21:37247716-37247738 TGGCAGGGGTGGATTTGGAGAGG + Intronic
1179582656 21:42353229-42353251 CAGAAGTGGCAGAAGTGGAGTGG - Intergenic
1179636722 21:42716371-42716393 AAGCTGGGGAGGATGTGGAGCGG - Intronic
1180842475 22:18965785-18965807 CAGCAGGAGTGGGTGGGGAGTGG - Intergenic
1181059011 22:20273071-20273093 CAGCAGGAGTGGGTGGGGAGTGG + Intronic
1181173926 22:21025545-21025567 CAGCAGCGGGGGATGTGAAGGGG - Intronic
1181915155 22:26273909-26273931 CAGCAGGTGTAGACCTGGCGTGG + Intronic
1182891864 22:33825868-33825890 CAGCAGGTGTGGATGTGGGAAGG + Intronic
1183413120 22:37666867-37666889 CAACAGGGGTGGAGGTGGCGGGG - Exonic
1183736252 22:39646460-39646482 CAGCAGGGAGACATGGGGAGAGG - Intronic
1184171329 22:42761493-42761515 CAGCAAGGGAAGCTGAGGAGTGG + Intergenic
1184235392 22:43180441-43180463 CAGCAGGGGTGGGTGAGGAATGG + Intronic
1184766627 22:46575911-46575933 CATCAGGGCTAGACCTGGAGGGG + Intergenic
1185070914 22:48655160-48655182 GGGCAGGGCTGGATGTGGAGTGG - Intronic
1185272588 22:49935821-49935843 GAGCAGGGGTAGGGGCGGAGGGG + Intergenic
1185397807 22:50601429-50601451 CGGCAGCGGCAGATGGGGAGGGG - Intronic
951588380 3:24237808-24237830 CAGCAGTGGCAGAGGTGGAATGG + Intronic
952600697 3:35078612-35078634 CAGAAGTGGCAGAGGTGGAGGGG + Intergenic
954133773 3:48572770-48572792 CAGCAGGGGTGGTGGTGGAGAGG - Intronic
954365575 3:50144430-50144452 CAGCAGGGGGATCTCTGGAGGGG - Intergenic
954689540 3:52388407-52388429 CAGCAGGGCTTGCTGTGGGGCGG - Exonic
954934114 3:54311297-54311319 CAGCAAGGAGAGATGCGGAGGGG - Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
959593286 3:108102298-108102320 CAGCCGGGGTAGTTGTCGAGAGG - Intergenic
961506554 3:127374377-127374399 CACCAGGGGCAGGTGTGGTGGGG - Intergenic
962990676 3:140574373-140574395 GAGCAGGGGTAGATGTGCCTGGG + Exonic
964383800 3:156126069-156126091 GAGCAGGAGGAGATGGGGAGGGG + Intronic
964616589 3:158672784-158672806 CAGCAGGTGGAGGTGTGGGGAGG + Intronic
964671954 3:159236399-159236421 CAGCAGGGATAGAAGGGAAGTGG + Intronic
966899091 3:184467520-184467542 AAGCAGGGGAGGATGTGGTGTGG - Intronic
966926203 3:184646152-184646174 CAGCAGGCGGTGATGTGGGGAGG + Intronic
967296977 3:187974758-187974780 CAGCCTGGGTACATGTGGAAAGG - Intergenic
967332149 3:188301205-188301227 AAGCAGGTGTAGATATGGATAGG - Intronic
968858872 4:3150535-3150557 GGGCAGGGGCAGATGTGGGGAGG - Intronic
969443031 4:7228435-7228457 CAGCAAGGGTGGATGAGGTGCGG + Intronic
969849154 4:9943074-9943096 CAGCTGGGGGAGAGGTGGGGAGG - Intronic
970645628 4:18117318-18117340 GAGCAGGGGAGGATGGGGAGAGG + Intergenic
971344540 4:25799600-25799622 CAGCAGGGGTGCACGTGGGGAGG + Intronic
973207523 4:47576865-47576887 CAGGAGGGGCAGATGTGAAGAGG - Exonic
974816901 4:67016725-67016747 CAGCAAGTGCTGATGTGGAGTGG - Intergenic
975151972 4:71032846-71032868 CAGCCTGGGTAGAAGGGGAGAGG - Intergenic
975152028 4:71033160-71033182 CAGCCTGGGTAGAAGGGGAGAGG - Intergenic
975997812 4:80336553-80336575 CAGCGGGGGTAGCTGGGGAGGGG - Intronic
976264196 4:83174767-83174789 CAGCAGGAATAGATATAGAGGGG - Intergenic
976922777 4:90458304-90458326 CAGCAGTGGTCCATGTGGAGTGG - Intronic
977891710 4:102319622-102319644 GAGCAGGGGTAGGAGTGGGGAGG - Intronic
979468585 4:121070563-121070585 CAGCAGGAGGAGGGGTGGAGGGG + Intronic
980869900 4:138598978-138599000 CAACAGGGGAGCATGTGGAGAGG - Intergenic
981042649 4:140237706-140237728 CAGCAGGGGAAGGGGAGGAGCGG - Intergenic
981764418 4:148231773-148231795 CAGCAGTGGTAGAGATTGAGAGG - Intronic
983170778 4:164534125-164534147 CAGCCAAGGTAGAAGTGGAGAGG + Intergenic
986256715 5:6107003-6107025 CAGGAGGGGTACATGCTGAGGGG + Intergenic
986830551 5:11572503-11572525 CAGCAGGAACAGGTGTGGAGAGG - Intronic
987996592 5:25290114-25290136 CACCAGGGCCTGATGTGGAGTGG + Intergenic
989348351 5:40454528-40454550 TATCAGGGGTGGATGGGGAGGGG - Intergenic
990357063 5:54978911-54978933 GAGCAGGAGAAGATGGGGAGGGG - Exonic
990404815 5:55478633-55478655 CAGCAGAGGAAGATGAGGAGAGG + Intronic
993496128 5:88611145-88611167 GAGCAGTGGTACATGTGGGGAGG - Intergenic
995044570 5:107630953-107630975 CAGCAGGACAAGATGTGGAGGGG - Intronic
998392315 5:141795294-141795316 CAGCAGAAGTTGCTGTGGAGAGG - Intergenic
998588182 5:143450078-143450100 CAGCTGTGGTAGATGTGATGGGG + Intergenic
998897992 5:146820752-146820774 CAGCAGAGGAAGATTTGGAGAGG - Intronic
998946253 5:147342496-147342518 CAGCAGGTGTGGATGTGAGGAGG + Intronic
999231590 5:150065194-150065216 CAGCAGGCCTAGATGGGGAGGGG - Intronic
1001229520 5:169973983-169974005 CAGCAGGGGGAGAGGTGGTGAGG + Intronic
1001653511 5:173331086-173331108 CCGCAGGGGTAGAAGTGGGATGG + Intergenic
1001712061 5:173786915-173786937 CAGCAGGTGCAGAGGTGCAGAGG - Intergenic
1002170002 5:177369638-177369660 AAGCAGCAGTAGATGTGGATGGG + Intronic
1005597474 6:27393344-27393366 AAGCAGGAGAAGAGGTGGAGAGG - Intronic
1005894013 6:30163054-30163076 CACCATGGGCAGATGTGGTGAGG + Intergenic
1006407182 6:33852127-33852149 CAGGAAGGGCAGATGGGGAGGGG + Intergenic
1006598264 6:35209223-35209245 CAGCTGGGGCACAGGTGGAGAGG + Intergenic
1006822838 6:36912135-36912157 CTGCAGAGGAAGATGTGGTGAGG - Intronic
1007203902 6:40133456-40133478 CAGGTGGTGTAGATGTGGTGTGG - Intergenic
1007250587 6:40492342-40492364 GAGCAGGGGGAGCTGTGGGGCGG - Intronic
1008514415 6:52306291-52306313 CAGGAGAGGTGGAGGTGGAGGGG + Intergenic
1009994847 6:70886607-70886629 CAGGTGGGGTGGACGTGGAGAGG - Intronic
1011296047 6:85827281-85827303 CAGCAGTGGCAGCTGTGGACTGG - Intergenic
1011296264 6:85829531-85829553 CAGCAGGGACAGTTGTGGGGTGG - Intergenic
1011631330 6:89327812-89327834 CAGCAGAGGTTGAGGTGGTGGGG + Exonic
1012378510 6:98591077-98591099 AAGCAGGGGTAGGTGTGTTGGGG + Intergenic
1012709434 6:102581417-102581439 CAGCAGCGGTCCATCTGGAGTGG + Intergenic
1014433458 6:121396389-121396411 AATCAGGGGGAGATGTAGAGAGG + Intergenic
1014928141 6:127299327-127299349 CAGTGGGGTAAGATGTGGAGGGG + Intronic
1015052941 6:128863720-128863742 CTGCAGGGAGAGATGGGGAGGGG + Intergenic
1015899018 6:138045971-138045993 CAGTAGTGGTGGAGGTGGAGAGG - Intergenic
1015942691 6:138467606-138467628 CAGTAGGACAAGATGTGGAGGGG + Intronic
1016117379 6:140303686-140303708 CAGCATGGGTAGCTGGAGAGGGG + Intergenic
1019076949 6:169395368-169395390 CAGCAGTTGTAGATGTGTTGTGG + Intergenic
1019224624 6:170500002-170500024 CAGCAGGGAGGGATCTGGAGTGG - Intergenic
1019285387 7:220644-220666 CAGCAGGGGGCGGTCTGGAGAGG + Intronic
1019789152 7:2999196-2999218 CAGGAGGGACACATGTGGAGCGG - Intronic
1020825335 7:13020589-13020611 CAGCAGGGATACAGGTGGAGAGG - Intergenic
1023607565 7:41943867-41943889 CAGAAGAGGAAGAGGTGGAGAGG - Intergenic
1024921918 7:54566206-54566228 CAGCAGGTCTAGATGAAGAGAGG - Intronic
1025014485 7:55427903-55427925 CAGCAGCAGCAGCTGTGGAGGGG + Intronic
1026336652 7:69399454-69399476 CAGAAGGGATAGATGGGGAAAGG - Intergenic
1029593165 7:101520690-101520712 CAGCAGGGGGACATGTGGAGTGG + Intronic
1029608615 7:101614778-101614800 CAGCAGGGGTGGAGGTGGAGAGG - Intronic
1029996735 7:105014102-105014124 CCGCAGGGGCAGAGGGGGAGGGG - Intergenic
1031682981 7:124697173-124697195 AATCAGGTGTTGATGTGGAGAGG + Intergenic
1032329202 7:130962068-130962090 AAGCAGAGGTAGGTGGGGAGGGG - Intergenic
1033511624 7:142065377-142065399 CAGAAGAGGGAAATGTGGAGCGG - Exonic
1033514696 7:142094406-142094428 CAGAAGAGGGAAATGTGGAGCGG - Intronic
1033521082 7:142160942-142160964 CAGCAGGGGTTGATAGTGAGTGG - Intronic
1033524405 7:142196196-142196218 CAGAAGAGGGAAATGTGGAGCGG - Intronic
1033586739 7:142779898-142779920 TAGCAGGAGCACATGTGGAGAGG - Intergenic
1034022333 7:147658584-147658606 CTGCAGGGGGAGATTTGGCGGGG - Intronic
1035681795 8:1493789-1493811 CGTCAGGGGTAGATGCGGAAGGG + Intergenic
1036709710 8:11070269-11070291 CAGCAGGGATTGATGAGGCGTGG - Intronic
1036791275 8:11721889-11721911 CAGGAGGTGTAGAGGTGAAGAGG + Intronic
1037395019 8:18432554-18432576 CAGCAGGGCTTGTTGTGGGGTGG + Intergenic
1038265932 8:26040120-26040142 CAGGAAAGGAAGATGTGGAGAGG + Intronic
1038640437 8:29320269-29320291 AAGAAGGGGGAGATGTGGCGGGG + Intergenic
1038666196 8:29540109-29540131 AAGCAGGTGGGGATGTGGAGAGG + Intergenic
1038768578 8:30454404-30454426 CATTAGGGGTATATGTGTAGGGG + Intronic
1039148829 8:34480257-34480279 GAGCAGGGGTTGGGGTGGAGGGG + Intergenic
1039447705 8:37646043-37646065 CAGCAAGAGCAGTTGTGGAGAGG + Intergenic
1041807050 8:61863010-61863032 CAGCAAGGGTAGTTGGAGAGTGG + Intergenic
1042190162 8:66177918-66177940 CAGCAAGGGCAGAAGTGGAGAGG - Intronic
1042303137 8:67307588-67307610 GTGCAGGGGTAGAGCTGGAGGGG + Intronic
1043412208 8:80009261-80009283 CAGCAGGGCTTGCTGTGGGGTGG + Intronic
1046135308 8:110018503-110018525 CAGCAGGGGCAATTGTGGACTGG + Intergenic
1047321205 8:123785402-123785424 CATTAGGGGTAGATGTAGGGAGG + Intronic
1047331906 8:123897131-123897153 CTGCAGTGGCAGTTGTGGAGGGG - Intronic
1048184115 8:132223430-132223452 GAGCAGGGGTAGCTTGGGAGAGG + Intronic
1050233527 9:3554392-3554414 AGGCAGGGGTAGAGGTGGGGTGG - Intergenic
1052660833 9:31428867-31428889 TAGCAATGGTAGTTGTGGAGTGG + Intergenic
1053156413 9:35783451-35783473 CAGGAGGGGTAGATGGGGTGAGG - Intergenic
1056553888 9:87673487-87673509 CAGCAGTGGAAGATGTGCAGGGG + Intronic
1057726294 9:97571001-97571023 CAGAAGGGGTAGGGGTGGGGAGG - Intronic
1058139532 9:101342574-101342596 GAGGAGGGGGAGATGGGGAGGGG + Intergenic
1058704718 9:107628752-107628774 CAGCAAAGGTAGAGGTGGATTGG - Intergenic
1059404869 9:114093302-114093324 CAGCAGGGGCAGGAGTAGAGGGG + Exonic
1059940038 9:119349758-119349780 CAGCAGGGGGATCTGTGGAGGGG + Intronic
1060459735 9:123839321-123839343 GGGCAGGGATAGAGGTGGAGAGG - Intronic
1060879631 9:127108971-127108993 CAGCAGAGGTAGAAGGGAAGAGG + Intronic
1060962837 9:127693354-127693376 CAGCAGGAGCAGAGGAGGAGAGG - Intronic
1060969963 9:127732282-127732304 CAGGAAGGGTAGGTGGGGAGGGG + Intronic
1061546636 9:131308404-131308426 CAGGAGGGGAAGATGAGGTGGGG - Exonic
1061889679 9:133611601-133611623 CAGCATGGGGAGAAGTGGAAGGG - Intergenic
1062041934 9:134408289-134408311 CAGCAGCGGTACCTGAGGAGCGG - Exonic
1062044741 9:134419804-134419826 CAGCAGGGCTAGGCCTGGAGGGG - Intronic
1062528753 9:136990336-136990358 AAGCAGGGGTGGATGGGAAGTGG - Intergenic
1186196291 X:7113079-7113101 CAGCTGGGGCAGCAGTGGAGGGG + Intronic
1186459961 X:9740081-9740103 CAGCAGTGGGAGAAGGGGAGAGG + Intronic
1186485767 X:9933084-9933106 GAACAGGGGTAGATGTGAATAGG + Intronic
1187110997 X:16300201-16300223 GAGCATGGATAGATGTGGACAGG - Intergenic
1189270202 X:39746280-39746302 CAGAAGGGGGAGACGTGGTGAGG - Intergenic
1189371690 X:40434077-40434099 CTGGAGGGGTAGGGGTGGAGTGG - Intergenic
1190214401 X:48470133-48470155 CAGCAGGGGAACAGGTGCAGGGG + Exonic
1190457135 X:50637397-50637419 CAGCAGGAATAGTGGTGGAGTGG - Intronic
1191645431 X:63475605-63475627 AAGCAGGGGCAGATTTTGAGAGG - Intergenic
1191784576 X:64903726-64903748 CAGAGGGGGGAGATATGGAGGGG - Intergenic
1194258302 X:91662384-91662406 CAGGAGGGGCAGAGGTGGAAAGG + Intergenic
1194660359 X:96624310-96624332 CAGCAGAGGGAGATGGGGTGGGG - Intergenic
1195875240 X:109534274-109534296 CAGCTGAGTTAGAGGTGGAGGGG - Intergenic
1196196566 X:112843115-112843137 CAGGAGAGCTAGATGTGGGGGGG + Intergenic
1198526738 X:137509121-137509143 CATCTGTAGTAGATGTGGAGAGG + Intergenic
1200288783 X:154851049-154851071 CAGAAGGAGTGAATGTGGAGTGG - Intronic
1200795867 Y:7340720-7340742 CAGCATGGATGGAGGTGGAGAGG - Intergenic
1200933015 Y:8714288-8714310 GAGCAGTGGTAGATGAGGATGGG + Intergenic