ID: 916936115

View in Genome Browser
Species Human (GRCh38)
Location 1:169629879-169629901
Sequence AACTCACAAGGGTGTTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916936107_916936115 26 Left 916936107 1:169629830-169629852 CCTCTGTAAACCACGATGGCTTT 0: 1
1: 0
2: 0
3: 7
4: 89
Right 916936115 1:169629879-169629901 AACTCACAAGGGTGTTGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 286
916936108_916936115 16 Left 916936108 1:169629840-169629862 CCACGATGGCTTTATTTGTAAAA 0: 1
1: 0
2: 4
3: 55
4: 502
Right 916936115 1:169629879-169629901 AACTCACAAGGGTGTTGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916936115 Original CRISPR AACTCACAAGGGTGTTGGGA GGG Intronic
900982624 1:6055071-6055093 ACCTCATGAGGGTGTTTGGAGGG + Intronic
901320258 1:8335677-8335699 AACTCAGAAAGGTTCTGGGAAGG - Intronic
902134724 1:14295104-14295126 AACTCACAGGGTGGTTGAGAAGG + Intergenic
903671888 1:25040909-25040931 ACCTCCCAGGGGTGTTGTGAAGG - Intergenic
904608479 1:31712054-31712076 ACCTCACAAGGATGCTGTGAGGG + Intergenic
905004506 1:34698873-34698895 AACTCACCTGGGTGTAGGGGAGG + Intergenic
905444478 1:38017111-38017133 ATCCCAGAAGGTTGTTGGGAGGG - Intronic
905553622 1:38863552-38863574 ACCTCACAGGGTTGTTGTGAGGG - Exonic
906649633 1:47503469-47503491 GACTCAGAATGGTGGTGGGATGG + Intergenic
908482935 1:64561191-64561213 AATTCAAAAGTGGGTTGGGAAGG - Intronic
908739326 1:67310687-67310709 ATCTCACAGGATTGTTGGGAGGG - Intronic
909254863 1:73407503-73407525 AAATCACAAGGGTGTTGATTGGG - Intergenic
909504868 1:76377407-76377429 AACTTACAACTGTGGTGGGAGGG + Intronic
909937487 1:81569920-81569942 CACTCACATGGGTATTGGCAGGG + Intronic
911622221 1:100078244-100078266 AATTCACAAGAGTGCTGTGAGGG - Intronic
911765857 1:101673804-101673826 AATTCACATGTGTTTTGGGAAGG + Intergenic
912392296 1:109311921-109311943 ACCTCACAATGTTCTTGGGATGG - Exonic
912414763 1:109500343-109500365 ACCTCACAGGGATGTTGTGAGGG + Intronic
913207106 1:116549294-116549316 AACTAACAAGGGGTTAGGGAAGG + Intronic
913270009 1:117084008-117084030 AAGTCACAAGAGTCTTGAGAAGG - Exonic
914771381 1:150688830-150688852 AAATCAGATGGGTGGTGGGAAGG - Intronic
915315407 1:155026041-155026063 AAATCACAGGGGTGTTGAGGGGG - Intronic
915594043 1:156886341-156886363 GGCTCACGGGGGTGTTGGGAGGG + Intergenic
916019823 1:160781921-160781943 ACCTTACAAGTCTGTTGGGAAGG - Intergenic
916359960 1:163957522-163957544 AAATCACAAGGGTGTTGATTGGG - Intergenic
916936115 1:169629879-169629901 AACTCACAAGGGTGTTGGGAGGG + Intronic
920069574 1:203292602-203292624 ACCTTAAAATGGTGTTGGGAGGG - Intergenic
920346931 1:205312262-205312284 ACCTCCCAAGGTTGTTGTGAGGG - Intronic
921980283 1:221249343-221249365 AAGTCACAAGGGTGATAGGCAGG + Intergenic
922326462 1:224532865-224532887 AACTCACAAGGTGGTTGCAATGG - Intronic
922345807 1:224695506-224695528 AACTCACAGGGTTGCTGTGAAGG - Intronic
922356476 1:224780998-224781020 ATCTCACAAGGGTGATGCAAAGG - Intergenic
922979795 1:229816130-229816152 GAATCACAAGGGGGTGGGGAAGG - Intergenic
923126061 1:231035564-231035586 ACCTCGCACGGGTGCTGGGAAGG + Intronic
1063789676 10:9428500-9428522 AACTCAAAAGGATGGTGGGTAGG - Intergenic
1064619380 10:17199623-17199645 AACTCACAAGCCTGTTAAGATGG + Intronic
1065390749 10:25178131-25178153 AACTCATAAGGTTGTTGTAAGGG - Intronic
1067195764 10:44116697-44116719 GACTCACGAGGGTGATGGGAAGG + Intergenic
1069894809 10:71673760-71673782 ACCTCACAGGGCTGTTGTGAGGG + Intronic
1069894926 10:71674599-71674621 ACCTCACAGGGCTGTTGTGAGGG - Intronic
1070195982 10:74156818-74156840 ACCTCATAAGGATGTTGAGAGGG + Intronic
1071563924 10:86662037-86662059 GGCTCACAAGGCTGGTGGGAGGG - Intronic
1071859087 10:89654529-89654551 AACACATAAAGGTGCTGGGAGGG + Intergenic
1072049601 10:91690147-91690169 AACGCACAAGGGTGATAGCAAGG - Intergenic
1072974475 10:100045726-100045748 ACCTCACAGGGTTGTTGTGAAGG + Intronic
1073926989 10:108527985-108528007 TACTCACAAGGGTTTATGGAAGG + Intergenic
1075958370 10:126545126-126545148 ATCGAACAAGGGTGTTAGGAGGG - Intronic
1076584569 10:131536752-131536774 GATTCACAAGAGTGTTGGGTCGG - Intergenic
1077456292 11:2683120-2683142 AACTCAGGAGGGTGTGGGGATGG + Intronic
1079874765 11:25842992-25843014 GAGTCACAAGGATGTTGTGAAGG + Intergenic
1080677004 11:34437558-34437580 AACTCATAGGGTTGTTGGGAGGG + Intergenic
1080830921 11:35892633-35892655 AAATCAGAAGGGTAGTGGGATGG + Intergenic
1082081331 11:48014665-48014687 ACCTCACCAGGCTGTTGTGAGGG - Intronic
1082089874 11:48080600-48080622 AAGTCAGAAGGGTGTTGGGTTGG + Intronic
1084095095 11:66906080-66906102 AACTCTCAAAGTTGTGGGGAAGG + Intronic
1084500746 11:69533846-69533868 CCCTGACAAGGGTGTGGGGAAGG - Intergenic
1086057004 11:82658494-82658516 AACTTACAATTGTGGTGGGAAGG + Intergenic
1089557664 11:119323503-119323525 AACTCACAAGGGTGATGCCAAGG - Intergenic
1091321164 11:134652975-134652997 CACTCTCAAGGGTTGTGGGAAGG - Intergenic
1091375565 12:22754-22776 AAGGCAGAAGGGAGTTGGGATGG - Intergenic
1091541944 12:1470003-1470025 AACTCACAAGGGCCATGGAAGGG - Intronic
1091766783 12:3126157-3126179 ACCTCACAGGGATGTTGTGAGGG + Intronic
1092699029 12:11206107-11206129 AACTTACAATCGTGGTGGGAGGG + Intergenic
1093320807 12:17711926-17711948 GACTCAGAAGGGTAGTGGGAGGG - Intergenic
1093502703 12:19830413-19830435 AACTCAAAATGGAATTGGGATGG - Intergenic
1094415900 12:30214542-30214564 AACTCAGAAGGGTGGTGGGGAGG - Intergenic
1094457343 12:30651424-30651446 AAAACAAAAGTGTGTTGGGAGGG + Intronic
1096958898 12:55557440-55557462 AACTCATAAGGGTGGGGGGCAGG - Intergenic
1097103542 12:56606382-56606404 AACAGACAAGGGTGCTGGGGAGG + Intronic
1097371962 12:58795058-58795080 CACTCACATGGTTGTTGGCAGGG + Intronic
1097738447 12:63209903-63209925 AACTCATCAAGGTGTTGGCAGGG - Intergenic
1100478960 12:94959630-94959652 GACTCACGAGGCTGTTGAGAAGG - Intronic
1102875321 12:116444407-116444429 AACTCCCAAGTGTTGTGGGAGGG + Intergenic
1103518242 12:121521155-121521177 ACCTCACAAGGCTGCAGGGAGGG + Intronic
1104214563 12:126723427-126723449 AACTCACATGGGGGCTGGGCAGG + Intergenic
1104479881 12:129098554-129098576 ACCTCACAGGGCTGTTGTGAAGG - Intronic
1104651033 12:130534213-130534235 ACCTTAGAAGGGTGGTGGGAGGG + Intronic
1104852846 12:131886124-131886146 AACTCAAAGGGGTGGTGGGCAGG + Intergenic
1105511841 13:21058536-21058558 AAATCACAGGGTTGGTGGGAGGG - Intronic
1109229511 13:59739443-59739465 TACTCAAAAGGGTATTGTGAGGG - Intronic
1110094258 13:71496552-71496574 GACTCAGAAGGGTGTGGGAATGG + Intronic
1112980265 13:105375413-105375435 AACTCACATTGGGGTTGGGGTGG + Intergenic
1113112297 13:106836423-106836445 GATTAACAAGGTTGTTGGGAAGG + Intergenic
1113824494 13:113240691-113240713 AAGTTACCAGGGTGTAGGGATGG + Intronic
1116412946 14:44647063-44647085 CACTCACATGGCTGTTGGCAGGG - Intergenic
1118686838 14:68299815-68299837 AGATCACATGGGTATTGGGAAGG + Intronic
1119963976 14:78892451-78892473 AACTCACAAGCGTGTTGCTCAGG - Intronic
1120072310 14:80117454-80117476 AATTCACAAGTGTTGTGGGAGGG - Intergenic
1120144619 14:80966343-80966365 AACTGCCAAGGGTGTTGAGATGG - Intronic
1121011275 14:90521604-90521626 AGCTCACAAAGGTGTTTGGGAGG + Intergenic
1122198896 14:100109967-100109989 ACCTCACAGGGTTGTTGTGAGGG + Intronic
1122321269 14:100857360-100857382 ACCTCACAGGGCTGTTGTGAGGG + Intergenic
1122322012 14:100860922-100860944 ACCTCACAGGGCTGTTGTGAGGG + Intergenic
1124068776 15:26371593-26371615 CACACACAAGGGTTTGGGGAGGG - Intergenic
1124898475 15:33799486-33799508 AACACACAAAGGTACTGGGAAGG + Intronic
1125216573 15:37282674-37282696 AAGTCACTACTGTGTTGGGATGG - Intergenic
1125326530 15:38541174-38541196 ACCTCAAAAGGTTGTTGTGATGG - Intronic
1125956788 15:43795954-43795976 ACCTCACAGGGTTGTTGTGAGGG + Intronic
1126291693 15:47087746-47087768 AACTTACAATGATGGTGGGAGGG - Intergenic
1126749498 15:51862183-51862205 GACTGACAAGGTTGGTGGGAGGG - Intronic
1130543022 15:84835437-84835459 AACACACAAGGTGGATGGGAAGG - Intronic
1132800386 16:1749343-1749365 AACTCTCCAGGAGGTTGGGAGGG + Intronic
1135467943 16:22703349-22703371 ACCTCACTTGGATGTTGGGAGGG + Intergenic
1135904168 16:26495505-26495527 GACTCAGAAGGGTGAAGGGATGG + Intergenic
1136068399 16:27773910-27773932 ACCTCACAAGATTGTTGTGAGGG - Intronic
1137949217 16:52766815-52766837 AACTGACAAGGGAATGGGGAAGG + Intergenic
1138938953 16:61766141-61766163 AACTCAGAAGGGGGTAGGGTGGG - Intronic
1140143219 16:72279670-72279692 ACCTCACAGGGCTGTTGTGAGGG + Intergenic
1142049376 16:87948045-87948067 AGCTCACAGGGATATTGGGAGGG - Intergenic
1145778200 17:27544110-27544132 ACCTCAAAAGGCTGTTGTGAAGG - Intronic
1147256984 17:39187275-39187297 AGGTCAGAAGGTTGTTGGGAGGG - Intronic
1149500599 17:57149467-57149489 AATTTACAAGGTTGTTGGAATGG - Intergenic
1151512794 17:74571549-74571571 ACCTGGCAGGGGTGTTGGGATGG - Intergenic
1152248142 17:79196884-79196906 AACTCACATCGGTGTGGTGAGGG + Intronic
1156519627 18:37711215-37711237 ATCTCACAAGGGTGGAGGCATGG + Intergenic
1159078731 18:63711143-63711165 TACTCATAAAGTTGTTGGGAAGG + Intronic
1159361072 18:67403383-67403405 ATTTCCCAAGGTTGTTGGGAAGG - Intergenic
1159926739 18:74276260-74276282 AGCTCACGAGGGAGGTGGGACGG + Intronic
1160066930 18:75584175-75584197 AACCCTCAAGGGTGATGGAAGGG - Intergenic
1160667038 19:335768-335790 ATCTTGCCAGGGTGTTGGGAAGG - Intronic
1161201559 19:3017991-3018013 CACTTGCAAGGGTGTTGGAAGGG - Intronic
1161733972 19:5978884-5978906 CACTCACAAGGCTCATGGGAGGG + Intergenic
1163267018 19:16227675-16227697 CACTCACGTGGGTGTTGAGACGG - Exonic
1164094730 19:21997271-21997293 AATTCACATGGTAGTTGGGAAGG + Intronic
1164332882 19:24277534-24277556 AAATCACAAGGGTATTGATAGGG - Intergenic
1164991596 19:32688492-32688514 CACTCACATGGCTGTTGGCAGGG - Intergenic
1166331681 19:42081395-42081417 AACTTACAAGGTGGTGGGGATGG - Exonic
1167562034 19:50231786-50231808 TACTCACAAGTGTGGTGGGAAGG - Intronic
1167937610 19:52920729-52920751 AACTCAAAGGGGTGGTGGGCAGG - Intergenic
1168411494 19:56142970-56142992 AGCTCACAGGTCTGTTGGGAAGG + Intronic
925995169 2:9286992-9287014 AACTCACAAGGCTGTAAGGATGG - Intronic
926094983 2:10075361-10075383 AGCTCATAACCGTGTTGGGAAGG - Intronic
927341679 2:21990546-21990568 AAATCCCAAAGGTGTTTGGAAGG + Intergenic
927924588 2:27002139-27002161 AAGGAAGAAGGGTGTTGGGATGG + Intronic
930021978 2:47007181-47007203 CACCCACAAGGGAGTTCGGAGGG + Intronic
931473566 2:62564873-62564895 AGCCCAGAAGGGTCTTGGGAGGG + Intergenic
931863691 2:66386421-66386443 AAATCACAAGAGAGGTGGGAGGG + Intergenic
932089501 2:68792408-68792430 AACTCAGAAGGATGAGGGGATGG - Intronic
933321874 2:80786131-80786153 AAGTCACATGGCAGTTGGGAGGG - Intergenic
933590212 2:84224672-84224694 TATTCACAAGGGTGTTCAGATGG + Intergenic
934976564 2:98806682-98806704 ACCTCACAAGGATATGGGGAGGG + Intronic
936160723 2:110082372-110082394 AAATCACAAGGGTGTTGATTGGG - Intergenic
936183941 2:110288982-110289004 AAATCACAAGGGTGTTGATTGGG + Intergenic
937692972 2:124777343-124777365 CACTAAAATGGGTGTTGGGATGG - Intronic
938709076 2:133959838-133959860 GACCCTCAAAGGTGTTGGGAGGG - Intergenic
938812147 2:134863442-134863464 AGCTCACAACGGTGCTGGCAAGG - Exonic
940089717 2:149901835-149901857 AACTTTCACTGGTGTTGGGATGG - Intergenic
941580469 2:167291897-167291919 ACCTCACAACGTTGTTGTGAGGG - Intergenic
941799163 2:169636021-169636043 GACTCGCATGGGTGCTGGGAGGG - Intronic
942092365 2:172505978-172506000 TCCTGAAAAGGGTGTTGGGAGGG + Exonic
942733492 2:179083720-179083742 AACTCACAATCGTGGTGGAAAGG + Intergenic
942884635 2:180908537-180908559 AACTTACATTGGGGTTGGGAGGG + Intergenic
943924282 2:193751999-193752021 AACTCAGAAGGGTGAGGGGTTGG - Intergenic
944452580 2:199857915-199857937 AAGTCACAGAGGTATTGGGAAGG - Intergenic
944591573 2:201222658-201222680 GATTCACAATGGTGTTGGGCAGG + Intronic
944882645 2:204028977-204028999 AACACACATGTGTGTTGGGTGGG + Intergenic
944986474 2:205183191-205183213 AACACCCAGGGGTGTTGGCAGGG + Intronic
945977197 2:216280194-216280216 AACTCACAGGAGGGCTGGGAGGG + Intronic
945980593 2:216307344-216307366 AAATTACAAGGGGGGTGGGAAGG + Intronic
946112586 2:217433201-217433223 AAGTCACAATGGTGTAGGGCAGG - Intronic
946453511 2:219801366-219801388 AACTCACAGGGTTATTGAGAGGG - Intergenic
947409186 2:229817534-229817556 AACTCACAACTGTGTTGAAAAGG + Intronic
947502077 2:230678248-230678270 CACTCACAGGGTTGTTGGCAGGG + Intergenic
1174050606 20:47764897-47764919 AACTCACAAGGTGGTTGTAAGGG - Intronic
1174390002 20:50213225-50213247 ATGTCACAAGGATGTTGGGAGGG + Intergenic
1177838456 21:26211277-26211299 AAGAAAGAAGGGTGTTGGGAAGG - Intergenic
1178477975 21:32954434-32954456 ATCTCATAAGGGCTTTGGGAAGG - Intergenic
1179112260 21:38457506-38457528 AAGTCACCAGGCTGTTGGGCAGG - Intronic
1180324270 22:11354602-11354624 GACTCAGAAGGGTGAAGGGATGG + Intergenic
1181673196 22:24435650-24435672 AGCTCACAAAGGTGTTCTGAAGG + Intronic
1181701327 22:24623069-24623091 AGCTCAAATGGGTGCTGGGATGG - Intronic
1181873962 22:25925336-25925358 AACTCGAAAGGGTGTTCTGAGGG - Intronic
1182386129 22:29942969-29942991 AAATCACAAGGGTATTGGTTGGG + Intronic
1182859965 22:33551038-33551060 AACTCAGAAGGGTAAAGGGATGG + Intronic
1183301957 22:37062938-37062960 ACCTCACAGGGTTGTTGTGAGGG + Exonic
1183794820 22:40107991-40108013 AACTCACATGATTGTTGGCAAGG + Intronic
1184251831 22:43264909-43264931 AATTCACATGGGTGGTGGCATGG - Intronic
1184369282 22:44072322-44072344 AACCCAAAAGGGTGGTGAGAGGG - Intronic
950613897 3:14144118-14144140 ACCTCACAAAGTTGTTGTGAGGG + Intronic
951834347 3:26964578-26964600 ACCTCACAGGGTTGTTGAGAGGG - Intergenic
953439899 3:42908170-42908192 AACTCTCAAGGGTGGAGGCAGGG - Intronic
953633885 3:44645173-44645195 ACCTCACAGGGTTGTTGTGAGGG + Exonic
954965665 3:54608422-54608444 ACCAGACAAGGCTGTTGGGAAGG - Intronic
955750748 3:62183798-62183820 AACTGAGAAGGGAGTGGGGATGG + Intronic
956379116 3:68647312-68647334 AATTCCCAAGTGTGGTGGGAGGG + Intergenic
957232458 3:77537916-77537938 AATTCCCACGGGTCTTGGGAGGG - Intronic
957509917 3:81174309-81174331 AAGGGAAAAGGGTGTTGGGAAGG - Intergenic
957771684 3:84701418-84701440 GACTCAGAAGGGTGTGGGGGTGG + Intergenic
958550731 3:95608423-95608445 AACTCCCATGTGTTTTGGGAGGG - Intergenic
960412559 3:117345764-117345786 AACTCAAAAGGATGATGGAATGG - Intergenic
960708391 3:120503749-120503771 AGCTCACAAACTTGTTGGGAAGG + Intergenic
963143684 3:141970502-141970524 AACTCATAAGGTTTTTGTGAAGG - Intronic
964635494 3:158853817-158853839 AACTCAGAAGGAAGGTGGGAGGG - Intergenic
965807067 3:172552636-172552658 AATTAAGAAGGGTGTTTGGATGG - Intergenic
966578388 3:181529922-181529944 AACTTAAAAGGTGGTTGGGAGGG + Intergenic
967456592 3:189693855-189693877 ACCTCACAAGGTCGTTGTGAAGG + Intronic
969522043 4:7684050-7684072 GTCTCACAGGGGTGTTGGAAGGG - Intronic
970221419 4:13815831-13815853 GACTCAGAAGGGTGTGGGGGTGG - Intergenic
970648075 4:18146045-18146067 TCTTCACAAGGGTCTTGGGAAGG + Intergenic
970908245 4:21242208-21242230 AACTCTCAGGGTTGTTGGGAGGG + Intronic
972266176 4:37462235-37462257 ATATCACAGGGTTGTTGGGAAGG - Intronic
975829493 4:78354201-78354223 AACTCACCAATGTGTTGGGAAGG - Intronic
978418247 4:108502077-108502099 AACTCACAAAGGTGATGAGAAGG + Intergenic
978437061 4:108697145-108697167 ACCTCACAAGGGTGTTATAAAGG - Intergenic
978640320 4:110862825-110862847 ACCTCAGAAGGCTGTTGTGAGGG + Intergenic
978899397 4:113929287-113929309 AACAAACAGGGGTGTTGGGGTGG + Intronic
980066123 4:128190675-128190697 AACTTACAATCGTGGTGGGAGGG - Intronic
981169784 4:141608059-141608081 AACACACAAGGGTGAAGGGAGGG - Intergenic
983943649 4:173563029-173563051 ACCTCACAAGGCTGTTGTGAAGG + Intergenic
985469188 5:27506-27528 AACTCACAAGGGTATTGACTGGG - Intergenic
986861226 5:11928723-11928745 ACATAACAACGGTGTTGGGAAGG + Intergenic
987051303 5:14148778-14148800 AACTGACAAGGGTGATGGTGTGG + Intronic
987565580 5:19580652-19580674 ATCTCACACAGGTGTTGTGAAGG - Intronic
988343377 5:30005386-30005408 AAATCACAAGGGTATTGGTTGGG - Intergenic
988438609 5:31206527-31206549 ACCTCGCAAGGGTGTTTGAAAGG + Intronic
988830504 5:34982413-34982435 AAATCACAAGGGTGTTGATCGGG + Intergenic
990329943 5:54715474-54715496 CACTCACATGGTTGTTGGCAAGG + Intergenic
991311200 5:65244650-65244672 ACCTCAAAAGAGTGTTGAGAAGG - Intronic
991545507 5:67777727-67777749 AACTCTCCAGGATGTTGGGCTGG - Intergenic
993007277 5:82442197-82442219 GTCTCTCAAGGGTATTGGGAGGG + Intergenic
995903629 5:117097205-117097227 AGCTCACAAGGGGGATGGGAGGG + Intergenic
997091862 5:130867639-130867661 AATTCACATGGTTGTTGTGAGGG - Intergenic
997244879 5:132338946-132338968 AAATCACAAGGGTGTTGATTGGG + Intronic
999575525 5:152972467-152972489 AATTCACACGTGTTTTGGGAGGG - Intergenic
1001059299 5:168474985-168475007 CTATCACAAGGGTGGTGGGAAGG - Intergenic
1001692164 5:173641333-173641355 AACTCACCAGGGTCCTGAGAAGG - Intergenic
1002098002 5:176843429-176843451 AAAGCAGAAGGGGGTTGGGAGGG + Intronic
1002319849 5:178368602-178368624 AAGTCACTATGGTGTGGGGAGGG - Intronic
1003995054 6:11531805-11531827 ACCTTAAAAGGGTGTTGTGAGGG + Intergenic
1005113508 6:22312455-22312477 AACTCCCAAGTGTTATGGGAGGG - Intergenic
1005395883 6:25381711-25381733 AACACACAAAGGTGCTAGGAGGG - Intronic
1006268244 6:32943503-32943525 AACTGTCAAGTGTGTTGGAATGG + Intronic
1007917908 6:45578083-45578105 AAGTCTAAAGGGGGTTGGGAGGG + Intronic
1008544845 6:52575928-52575950 AATTCACAAGACTGATGGGAAGG - Intronic
1012604527 6:101141651-101141673 AACTCACAATATAGTTGGGAAGG - Intergenic
1014050858 6:116952769-116952791 ACCTCATAAGGCTGATGGGAAGG - Intergenic
1014570071 6:122997038-122997060 ATCTCAGAGGGGTGGTGGGAAGG + Intronic
1015061816 6:128975588-128975610 AATTCCCAAGGGTCATGGGAGGG + Intronic
1015697101 6:135992895-135992917 ACTTCACAGGGCTGTTGGGAGGG - Intronic
1015760140 6:136649820-136649842 ATCTCAAAAGGCTGTTGTGAAGG - Intronic
1016832117 6:148444530-148444552 AACTCATAATGGGGTAGGGAGGG - Intronic
1018313888 6:162537795-162537817 AAGTGACAAGGGCCTTGGGAAGG - Intronic
1019199444 6:170302176-170302198 AACTTACAATCGTGTTGGAAGGG + Intronic
1019892726 7:3959567-3959589 GACTCACAAGGGTGTGGGGTGGG - Intronic
1019926809 7:4198338-4198360 AAGTCACAAGGGTGTTGGCTGGG + Intronic
1020387810 7:7626863-7626885 AAATCACAAGGGTATTGGTTGGG + Intergenic
1020758955 7:12243962-12243984 AACTCAAAATGGTGTGGTGATGG + Intergenic
1024389057 7:48786415-48786437 AATTCCCAAGTGTTTTGGGAAGG + Intergenic
1027603363 7:80268256-80268278 TACTGGCAAGGGTGTGGGGAAGG - Intergenic
1028353008 7:89872342-89872364 AACTCTCAAGGATGTTGGTCTGG - Intergenic
1029106230 7:98178817-98178839 AACTCACAAGGCTGTTGCAAGGG - Intronic
1031152728 7:118073472-118073494 TACTCACATGGCTGTTGGCAGGG - Intergenic
1031987512 7:128172641-128172663 AACTCACAGGGATGTTGCAAAGG - Intergenic
1032585735 7:133144766-133144788 TACTTACAAGGGTGTGGGCAAGG + Intergenic
1034071698 7:148192254-148192276 GACTCAGAAGGGTGTAGGGGTGG - Intronic
1035774671 8:2179051-2179073 ACCTCACAAGATTGTTGGGAGGG - Intergenic
1036620104 8:10419329-10419351 AATTCACAAGGGTGAGGGGTAGG - Intronic
1037895112 8:22646777-22646799 AAGTAACCAGGGTGTGGGGAAGG - Intronic
1038335060 8:26639301-26639323 AACTCACACGATTGTGGGGATGG + Intronic
1041243872 8:55872709-55872731 AGCTCACACAGGTGCTGGGAAGG - Intergenic
1044150490 8:88770675-88770697 AGCAAACAAGGGTGTTGGGGTGG - Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1047055129 8:121155537-121155559 ACCTCAGAAGGCTGTTGTGAGGG - Intergenic
1047644816 8:126859170-126859192 ACCTCACAGGGATGTTGTGAAGG + Intergenic
1048246263 8:132804953-132804975 ACCTCACAGGGATGTTGTGAGGG + Intronic
1048265316 8:132980405-132980427 AACACACAGAGGTGCTGGGAGGG + Intronic
1049182103 8:141228212-141228234 GACTCACAAGGGTCTTTGGACGG + Exonic
1049987536 9:965729-965751 AACTCACACAGGGATTGGGAAGG + Intronic
1052426515 9:28311853-28311875 AAATCACAAGGGTATTGATAGGG + Intronic
1052456639 9:28707606-28707628 AACTCCCAAGGGTGGTGGCTAGG + Intergenic
1055117477 9:72621356-72621378 AACTCCCAGGGATGTTGTGAGGG - Intronic
1056768399 9:89459518-89459540 AGCCTACAAGGGTGTTGGGGGGG + Intronic
1057412508 9:94829637-94829659 GACTCACAAGGGTGTTTTGTGGG - Intronic
1057573556 9:96221567-96221589 AAGGCACAAGGATGTTGGGGAGG + Intergenic
1057962735 9:99472119-99472141 GCCTCACAGGGCTGTTGGGATGG - Intergenic
1058758120 9:108102623-108102645 GACTCACAAGGGTGCAGAGAAGG + Intergenic
1058934680 9:109757978-109758000 AACTCTCAGTGGGGTTGGGAGGG - Intronic
1059000010 9:110338859-110338881 AATTCCCAAGGGTTGTGGGAGGG + Intergenic
1059646058 9:116269173-116269195 ATCTCACATGGCTGTTGGGTGGG - Intronic
1059698032 9:116747480-116747502 AACTCACAAGGTTGTTGAGAGGG - Intronic
1059716916 9:116921688-116921710 AACTTACAATCGTGTTGGAAGGG + Intronic
1060732120 9:126045401-126045423 ACCTCACAGGGCTGTTGTGAGGG - Intergenic
1061188955 9:129070762-129070784 TGCTGACAAGGGTGCTGGGAGGG + Exonic
1061620695 9:131809628-131809650 GACCCACAAAGGGGTTGGGAAGG + Intergenic
1062704135 9:137925577-137925599 AACTAATAAGGGAGTTGGTAAGG - Intronic
1185519797 X:729811-729833 TACTCACCAGGGTGTTAGCAGGG - Intergenic
1186835863 X:13437164-13437186 GACTCAGAAGGGTGAGGGGATGG + Intergenic
1186848280 X:13553215-13553237 AAGTCAGAAGGGAGGTGGGAAGG - Intergenic
1187732134 X:22266078-22266100 ACCTCACAGGGCTGTTGTGAGGG + Intergenic
1189494374 X:41495822-41495844 AATTCAGAAGGGTGAGGGGAGGG - Intergenic
1191997054 X:67106666-67106688 TACCCCCAAAGGTGTTGGGAGGG - Intergenic
1193151561 X:78129848-78129870 ACCTCACAGGGCTGTTGTGAGGG - Exonic
1193639813 X:83999385-83999407 ATCTTACAATGTTGTTGGGAAGG + Intergenic
1193692479 X:84663493-84663515 TATTCAGAAGGGTGATGGGATGG + Intergenic
1194279281 X:91927887-91927909 AATTCACAAGGGTGTGGAGGAGG + Intronic
1194329928 X:92569407-92569429 AAATCACAAGTGTGTTGAGGTGG - Intronic
1195574318 X:106432729-106432751 AAATCACAAAGTTGGTGGGAGGG + Intergenic
1196480587 X:116142370-116142392 AATTCCCAAGGGTTGTGGGAGGG + Intergenic
1197843486 X:130775592-130775614 CACTCTCAAGGGCGCTGGGACGG + Intronic
1198116341 X:133548705-133548727 AATTCCCAAGGGTTGTGGGAAGG + Intronic
1198163481 X:134030512-134030534 ACCTCACCAGGTTGTTGAGAGGG - Intergenic
1198316026 X:135467247-135467269 TAGTCACAAGGGAGTGGGGATGG + Intergenic
1198853770 X:140994723-140994745 GACTCACAAGGCTGTTTAGAAGG - Intergenic
1198863050 X:141091320-141091342 AACTTCCAAGGATGGTGGGAGGG + Intergenic
1198899640 X:141496067-141496089 AACTTCCAAGGATGGTGGGAGGG - Intergenic
1199999024 X:153047320-153047342 AATTCACCAGGGTGTGGGTATGG - Intergenic
1200596757 Y:5151382-5151404 AATTCACAAGGGTGTGGAGGAGG + Intronic
1200638634 Y:5688589-5688611 AAATCACAAGTGTGTTGAGGTGG - Intronic
1201744798 Y:17360121-17360143 ACCTCAGAAAGGTGGTGGGAGGG + Intergenic