ID: 916948666

View in Genome Browser
Species Human (GRCh38)
Location 1:169757433-169757455
Sequence CCAGCTAGTAAGTTAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916948666_916948670 26 Left 916948666 1:169757433-169757455 CCAGATTCTAACTTACTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 916948670 1:169757482-169757504 ATAAAGACATACCCCAGACTGGG 0: 75
1: 3426
2: 7403
3: 9059
4: 10679
916948666_916948669 25 Left 916948666 1:169757433-169757455 CCAGATTCTAACTTACTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 916948669 1:169757481-169757503 AATAAAGACATACCCCAGACTGG 0: 28
1: 1348
2: 5104
3: 7455
4: 8449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916948666 Original CRISPR CCAGCTAGTAAGTTAGAATC TGG (reversed) Intronic
909988514 1:82192275-82192297 CCAGCTATTGAGTTGGAATGTGG - Intergenic
912537253 1:110383923-110383945 ACAGCTTGGAAGTTAGAAGCAGG + Intronic
913613348 1:120530280-120530302 CCAGCAAGTAAGTCAGTGTCAGG - Intergenic
914371699 1:147031039-147031061 CCAGCAAGTAAGTCAGTTTCAGG - Intergenic
914577838 1:148991967-148991989 CCAGCAAGTAAGTCAGTGTCAGG + Exonic
915029055 1:152860494-152860516 GCAGTGAGTAAGTTAGAGTCTGG - Intergenic
916948666 1:169757433-169757455 CCAGCTAGTAAGTTAGAATCTGG - Intronic
921976054 1:221204607-221204629 CCAGCCAGTAAGTGACAGTCTGG - Intergenic
1063283047 10:4651785-4651807 CCATCTATTGAGTCAGAATCTGG - Intergenic
1065065169 10:21955240-21955262 CCAGTAAGTAAGTTAAAATTGGG - Intronic
1065849569 10:29775982-29776004 CCAGCCAGTAAGGAAGAAGCAGG - Intergenic
1068020195 10:51572435-51572457 CCAGGCAGTATGTTGGAATCTGG + Intronic
1075126087 10:119700221-119700243 CCAGTTAGAAAGAAAGAATCCGG - Intergenic
1078599916 11:12721094-12721116 CCAGGCAGTAAGTGAGAGTCTGG - Intronic
1079243152 11:18734949-18734971 ACTGCTAGTAAGTCAGAATCAGG - Intronic
1080280132 11:30547518-30547540 TAAGCTTGGAAGTTAGAATCTGG + Intronic
1080746945 11:35116650-35116672 CCAGCCAGTAAGCTGGCATCTGG + Intergenic
1081643798 11:44776361-44776383 CCAGCCAGCAAGTGAGAACCAGG - Intronic
1083003972 11:59323832-59323854 CCTGCTAGTCTGTTAGCATCAGG + Intergenic
1088477970 11:110263540-110263562 CCAGCTGGCAACTTAAAATCTGG + Intronic
1090464141 11:126918498-126918520 TCAGCTAGTTAATTAAAATCCGG - Intronic
1092027458 12:5254647-5254669 CCACCTAGGGAGTAAGAATCAGG + Intergenic
1100167422 12:91931872-91931894 CTAGCTTTTAAGTTAGAAGCAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1106956781 13:34947954-34947976 TCTGTTAGTAAGTTCGAATCTGG + Intronic
1109470043 13:62792002-62792024 CCAGCCACCAAGTTAGAATGAGG - Intergenic
1112688563 13:101862127-101862149 CCACGTAGAAAGTTAGAATCAGG + Intronic
1117212797 14:53518766-53518788 TCACCTAGTAAGTTACAATGTGG - Intergenic
1117507115 14:56415033-56415055 CCAGATAGTAAGTGAGGAGCTGG + Intergenic
1117711450 14:58533568-58533590 CCATCTAGTAAGTTCCCATCTGG + Intronic
1117966706 14:61213878-61213900 CCAGCTATTATGCTATAATCTGG + Intronic
1118086190 14:62420077-62420099 CCATCTAGAAAGGTAGAAACGGG + Intergenic
1123723459 15:23080294-23080316 CCAGCTAGTAAGTCATAATAGGG - Intergenic
1124834843 15:33186588-33186610 AGAGATAGTAAGATAGAATCTGG - Intronic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1136004987 16:27323262-27323284 CCAGGTAGGAATTTAGAATCTGG - Intronic
1137303422 16:47176583-47176605 GCAGCTAGAAAATTAGAAACAGG - Intronic
1138960382 16:62022317-62022339 CCAGCTTGTATGCTATAATCAGG + Intronic
1148975799 17:51527309-51527331 CCAGCTCATAAGTAGGAATCAGG + Intergenic
1149856966 17:60091205-60091227 GCAGCTACTAAGTTGGAGTCAGG - Intergenic
1156176265 18:34550452-34550474 ACAGCTGTTAAGTTAAAATCTGG - Intronic
1159585068 18:70276189-70276211 CCAGCTTGTGAATGAGAATCTGG - Intergenic
929531988 2:42758515-42758537 CCAGCTAGTAAGTGGCAGTCTGG - Intergenic
939541127 2:143495015-143495037 CCAGCTATTAACTTAATATCTGG + Intronic
939564679 2:143773027-143773049 CCAGTGAGTAAGTCAGAAACGGG - Intergenic
948374618 2:237513188-237513210 CCAGCTAGTAAGTGGGCCTCTGG + Intronic
1169510994 20:6263398-6263420 CCAGCTAGTAATTGCAAATCAGG - Intergenic
1169899623 20:10539748-10539770 CCAGCCAGCACATTAGAATCGGG + Intronic
1172887766 20:38242723-38242745 CCATCTAGTAAGTTAGTGGCAGG - Intronic
1182470952 22:30547963-30547985 CCATGTAGTAAGTGACAATCAGG + Intergenic
949183906 3:1167750-1167772 GCAGCTAAGAAGTTAGATTCAGG - Intronic
952955183 3:38552498-38552520 CCACCTAGTGAGTGAGAAGCTGG + Intronic
953794032 3:45969385-45969407 ACAGCTGGTAGGTGAGAATCAGG + Intronic
958882136 3:99684363-99684385 CTAGCTACCAAGTTAGAGTCAGG + Intronic
959855580 3:111152810-111152832 CCAGGTATTCAGTTACAATCAGG + Intronic
962011497 3:131396004-131396026 CAAGGTATTAAGTTAGTATCGGG + Intergenic
963393743 3:144704822-144704844 AGAGCTATTAAGTTAGAATGAGG - Intergenic
967493969 3:190122262-190122284 CCAGCTAGTCGTTTGGAATCTGG - Intronic
970961991 4:21882977-21882999 CCATGTAGTTATTTAGAATCTGG + Intronic
971560584 4:28075136-28075158 TCAGCTAGTAATTTAAAACCTGG - Intergenic
977365159 4:96058132-96058154 CCAGCTAGAAACTGAGATTCAGG - Intergenic
977384446 4:96321534-96321556 CCAGCATGTAAGTTATTATCAGG - Intergenic
978071282 4:104474496-104474518 TCAGCCAGTAAGTTAGCATCTGG - Intronic
980272831 4:130608939-130608961 CCAGTTTGTATGTAAGAATCAGG - Intergenic
984374566 4:178911108-178911130 CCAGGTTGTAAGTCAGAATCAGG + Intergenic
986495657 5:8339308-8339330 ACAGCAAGCAAGATAGAATCAGG + Intergenic
990289740 5:54337008-54337030 CCTTCTAGTAATTTAGAATTTGG - Intergenic
992261575 5:74975880-74975902 CTAGCTTGTAAGATAGTATCTGG - Intergenic
999050378 5:148517679-148517701 CGAGATTGTAATTTAGAATCTGG - Intronic
1000309298 5:160026008-160026030 ATAGCTAGTAAGTCAGAATTCGG + Intronic
1005022018 6:21427379-21427401 CCAGCTAGTTAGTTACTCTCAGG + Intergenic
1006176027 6:32122129-32122151 GCAGCTTGGAAGTCAGAATCTGG - Intronic
1014763318 6:125382159-125382181 GCAGCTAGTAAGTAAAAAACTGG - Intergenic
1016807159 6:148223199-148223221 CCACCTAGTTAGTTAGAGGCAGG - Intergenic
1020966415 7:14875347-14875369 CCTGCTTGTAACTTAAAATCTGG + Intronic
1024048349 7:45600496-45600518 ACAGCACGTCAGTTAGAATCTGG + Intronic
1027422304 7:78028948-78028970 TAAGCTAGTAAGTGAGAATCAGG + Intronic
1029618004 7:101671813-101671835 CCAGCTGGTGACTTAGACTCTGG - Intergenic
1031596207 7:123652259-123652281 CAAGCAACTAAATTAGAATCTGG + Intergenic
1031835699 7:126679543-126679565 CCAGATAGTAAGGTAGAAGCTGG + Intronic
1040894612 8:52352971-52352993 CCAGCTACTATGGTAGACTCAGG + Intronic
1043051616 8:75392784-75392806 CCACCTGGTAAGGTAGGATCAGG + Intergenic
1044463043 8:92469747-92469769 CCAGCTAGTAACTCAGAGTTAGG - Intergenic
1045176850 8:99734879-99734901 CCATCTAGTCATTTAGAATAGGG - Intronic
1045892686 8:107175558-107175580 CCAGCTAATTTATTAGAATCAGG + Intergenic
1046592159 8:116219894-116219916 CAAACTAGGAAATTAGAATCTGG + Intergenic
1047202283 8:122777369-122777391 ACAGCTGATAAGTTAGAAGCAGG - Intergenic
1047269957 8:123347693-123347715 ACAGCTAGTAAATTACAAACTGG - Intronic
1048095424 8:131287025-131287047 ACAGCTAGTCAGTCAGAAGCAGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049970054 9:814032-814054 CCAGCAAGTAGCTGAGAATCAGG + Intergenic
1056467616 9:86873546-86873568 CCATCTAGTAAGATATAGTCTGG - Intergenic
1058850868 9:109011557-109011579 CAAGCTAGAAAGTCATAATCTGG - Intronic
1060012372 9:120055207-120055229 CCACCTTCTAAGTTAAAATCTGG + Intergenic
1191971618 X:66823369-66823391 CCAGCTAGAAAGTTGGCATATGG - Intergenic
1193198544 X:78661400-78661422 CCAGATAGTACTCTAGAATCAGG + Intergenic
1194340947 X:92704876-92704898 CCAGCTAGTAAGTGACAGGCAGG - Intergenic
1195903236 X:109819834-109819856 CCAGCTAGTGAGTGGGCATCTGG - Intergenic
1197234936 X:124050688-124050710 CCAAGTAGTAAGGTATAATCTGG - Intronic
1198672229 X:139093315-139093337 CAGGGTAGTAAATTAGAATCAGG - Intronic
1200649301 Y:5821595-5821617 CCAGCTAGTAAGTGACAGGCAGG - Intergenic