ID: 916952435

View in Genome Browser
Species Human (GRCh38)
Location 1:169794709-169794731
Sequence TTGGAGTCACTTCCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916952425_916952435 30 Left 916952425 1:169794656-169794678 CCAGTCCCGCGGCTAGGAACGCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 74
916952426_916952435 25 Left 916952426 1:169794661-169794683 CCCGCGGCTAGGAACGCGCCTCT 0: 1
1: 0
2: 0
3: 3
4: 28
Right 916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 74
916952432_916952435 -5 Left 916952432 1:169794691-169794713 CCCATCACGCTGCAAGGCTTGGA 0: 1
1: 0
2: 0
3: 2
4: 79
Right 916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 74
916952433_916952435 -6 Left 916952433 1:169794692-169794714 CCATCACGCTGCAAGGCTTGGAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 74
916952430_916952435 0 Left 916952430 1:169794686-169794708 CCTCTCCCATCACGCTGCAAGGC 0: 1
1: 0
2: 0
3: 6
4: 145
Right 916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 74
916952428_916952435 7 Left 916952428 1:169794679-169794701 CCTCTTTCCTCTCCCATCACGCT 0: 1
1: 0
2: 2
3: 36
4: 452
Right 916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 74
916952427_916952435 24 Left 916952427 1:169794662-169794684 CCGCGGCTAGGAACGCGCCTCTT 0: 1
1: 0
2: 0
3: 0
4: 29
Right 916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916952435 Original CRISPR TTGGAGTCACTTCCGGCTGC AGG Intronic
900187684 1:1339959-1339981 TTGGGGTGACGTGCGGCTGCGGG - Intronic
900709791 1:4106530-4106552 TGTGAGTCACTTCTGGGTGCAGG - Intergenic
900710196 1:4108694-4108716 TAGGAGTCACCACCGTCTGCTGG - Intergenic
901533561 1:9868197-9868219 TGGGAGTCACTCCCTGCTGCTGG - Intronic
901629732 1:10642230-10642252 ATGGAGTCGCTGGCGGCTGCGGG + Intronic
905803377 1:40860052-40860074 TTGGGGTCAGTTCAGGCTTCAGG - Intergenic
906563324 1:46777614-46777636 TTGGAGTTTCTTCCTTCTGCTGG + Intronic
908466908 1:64405162-64405184 TTGAAGGCACTTCTGCCTGCAGG - Intergenic
909677904 1:78257972-78257994 TTGGTGACACGTCCAGCTGCAGG + Intergenic
913363705 1:118011789-118011811 TTGGAGAAACTTTTGGCTGCTGG + Intronic
916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG + Intronic
924937433 1:248784018-248784040 CAGGAGTCACTTCTGCCTGCAGG - Intergenic
1070566422 10:77606776-77606798 TTGGTGGCTCTTCCTGCTGCAGG - Intronic
1073196474 10:101695248-101695270 TTGGAGCCACTTCGGGGTGCGGG + Exonic
1075442986 10:122494223-122494245 TTGGGGGCACATCCGGCTGTCGG + Intronic
1077001586 11:326036-326058 GTGGAGTAACGTCCGGATGCTGG + Intronic
1087085909 11:94218822-94218844 TTGAAGCCACTTCTGGCTGGAGG + Intergenic
1090176856 11:124657608-124657630 TTGGATCCACTTCCGTGTGCTGG - Intronic
1094872210 12:34604794-34604816 TTGGAGGCACTTTCGCCTGTGGG - Intergenic
1096804114 12:54129854-54129876 ATGGAGGCACTTGGGGCTGCGGG - Intergenic
1104002209 12:124867107-124867129 GGGGAGTCACTTCCGGTGGCAGG + Intronic
1113484613 13:110645151-110645173 TTTGAGTCACAGCCGGCTGCAGG - Intronic
1115524218 14:34263488-34263510 TTGGAGTCACCTGGGGCAGCTGG + Intronic
1116428702 14:44820930-44820952 TTGGAGACACCTCCAGCTGCGGG + Intergenic
1119331835 14:73800655-73800677 CTGGAGTCCTTTCCTGCTGCAGG + Intergenic
1121231702 14:92363316-92363338 GTGAATTCACTTCTGGCTGCAGG - Intronic
1121606168 14:95241619-95241641 TTGGTGACACTTCCAGCTCCAGG - Intronic
1121820566 14:96962457-96962479 CTAGATTCAGTTCCGGCTGCAGG + Intergenic
1122672832 14:103385359-103385381 CTGTCGTCACTTCCGGCAGCCGG + Intergenic
1125380615 15:39082648-39082670 TTGGGGTCACTTCAGCATGCAGG - Intergenic
1125542106 15:40475574-40475596 CTGGAGGCACTACCGGCTGTGGG + Intergenic
1127498595 15:59535435-59535457 GTGCAGTCACTTCCGTTTGCTGG + Intergenic
1127800990 15:62477425-62477447 TTGGAGTCTCTTCTAGCTGCAGG + Intronic
1129320526 15:74772208-74772230 TTGGAGTCGCTGAGGGCTGCAGG + Intergenic
1131657970 15:94481648-94481670 TTGGAGTCACATCCAGCCACAGG - Exonic
1132181270 15:99754475-99754497 TGGGAATCACTGCCTGCTGCAGG + Intergenic
1133116400 16:3580207-3580229 TTGGATTCAGTTGGGGCTGCTGG - Intergenic
1133760897 16:8797625-8797647 TGGGATTTACTTCCGGCAGCAGG - Exonic
1134225285 16:12385337-12385359 CAGGATTCACTTCCTGCTGCAGG - Intronic
1142185214 16:88691643-88691665 TTGGCATCCCTTCCGGATGCAGG + Intergenic
1147149034 17:38503264-38503286 TTGGGGTCACTCCCAGCTGATGG + Intronic
1147897134 17:43758170-43758192 TAGGAGCCACGTCCAGCTGCTGG - Intronic
1149340187 17:55677662-55677684 TTGGAGTCTCTTACTGCTGCAGG + Intergenic
1150481689 17:65516235-65516257 TTGAAGTCCCTTCTGGCTACAGG + Intergenic
1151979923 17:77502710-77502732 ATGGAGACACTTCAGTCTGCAGG - Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1163494694 19:17639490-17639512 CTGGAGTCTCTCCGGGCTGCTGG + Exonic
1166500727 19:43339178-43339200 CTGGAGTCCCTTCCAACTGCTGG - Intergenic
1166509364 19:43394227-43394249 CTGGAGTCCCTTCCAACTGCTGG + Intergenic
1166608270 19:44165005-44165027 TTGTAGGCACTTCCGGCTCGAGG + Intergenic
934712931 2:96527536-96527558 TTTGAGTCAGATCCGGCGGCAGG + Intergenic
946596094 2:221307616-221307638 TTGCAGTCAATTCAGACTGCAGG + Intergenic
948013558 2:234669824-234669846 TTGGAGTCACTGCCCCCTGTTGG - Intergenic
948805070 2:240450356-240450378 TTGGAGTCAGGGCAGGCTGCAGG + Intronic
1176302987 21:5107529-5107551 ATGGAGCCACTGCCGACTGCAGG - Intergenic
1178103914 21:29298567-29298589 TGGGAGTCAGTTCAGGATGCGGG + Intronic
1179854038 21:44154395-44154417 ATGGAGCCACTGCCGACTGCAGG + Intergenic
1181402965 22:22662531-22662553 TTGGAGTCAGATCCTCCTGCAGG + Intergenic
1181683247 22:24510661-24510683 TTGCAGTGACTTCCCGCTGCTGG + Intronic
961044742 3:123700662-123700684 TTGGCTTCACTTGCCGCTGCAGG + Exonic
969282154 4:6177983-6178005 CCGGCTTCACTTCCGGCTGCAGG + Intronic
970593258 4:17577472-17577494 TTGCTGCCTCTTCCGGCTGCGGG + Exonic
971331723 4:25686895-25686917 TTAGAGTCACTTCAGGCTAATGG - Intergenic
981373402 4:143986505-143986527 TTGGTGTCATTTCCTGCAGCAGG + Intergenic
991426245 5:66494996-66495018 TGGGAGTCATTTCAGGCAGCGGG + Intergenic
1000145538 5:158449792-158449814 TAGGAGTCACTTAGGGTTGCCGG + Intergenic
1002930834 6:1633885-1633907 TTGGAGTATCTACCGCCTGCAGG + Intronic
1004252396 6:14033128-14033150 TTGTGGTCACTTCTGGCTGCAGG + Intergenic
1007271575 6:40641367-40641389 CTGGAGTCCCTTCTGGCTGTGGG + Intergenic
1015399500 6:132773072-132773094 TTGCAGTCAGCTCTGGCTGCTGG - Exonic
1017726195 6:157277545-157277567 GTGGAGTCACTTCTGGCTGGAGG - Intergenic
1020465818 7:8477663-8477685 TAGGAATCACCTCCTGCTGCAGG + Intronic
1022350880 7:29565402-29565424 TTGAAGTCACCCCCGGCTGACGG - Intronic
1025712757 7:63927366-63927388 TGGGAGTCCCTTCATGCTGCTGG + Intergenic
1026941806 7:74291349-74291371 TTGGAGTAAATTCCCCCTGCTGG - Intronic
1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG + Intronic
1031962262 7:128000691-128000713 TTGGAGTGTCTTCAGGCTTCAGG + Intronic
1033090426 7:138380566-138380588 TTGCAGGCAATTCTGGCTGCTGG - Intergenic
1037834215 8:22206847-22206869 TTGTGGTCACAGCCGGCTGCAGG - Exonic
1048604712 8:135955740-135955762 TTGGAGTCTCTACCAGGTGCTGG + Intergenic
1049275230 8:141716998-141717020 TTGCTGTCACTTCCCTCTGCTGG + Intergenic
1059938872 9:119338493-119338515 TGGCAGTCACTTCCGGTTTCTGG + Intronic
1060595511 9:124845685-124845707 GCGGAGACACTTCCGGTTGCTGG + Intergenic
1186093292 X:6072873-6072895 TTGGACTTAATTCGGGCTGCTGG - Intronic
1193964545 X:87969081-87969103 TGGGATACACTTCCGGTTGCTGG + Intergenic