ID: 916952473

View in Genome Browser
Species Human (GRCh38)
Location 1:169794904-169794926
Sequence CAGTGAGTCGAGTCCTCCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916952466_916952473 2 Left 916952466 1:169794879-169794901 CCTCCTCCGGACCTAAATCGCGC 0: 1
1: 0
2: 0
3: 0
4: 19
Right 916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 57
916952468_916952473 -4 Left 916952468 1:169794885-169794907 CCGGACCTAAATCGCGCACCAGT 0: 1
1: 0
2: 0
3: 1
4: 11
Right 916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 57
916952467_916952473 -1 Left 916952467 1:169794882-169794904 CCTCCGGACCTAAATCGCGCACC 0: 1
1: 0
2: 0
3: 0
4: 7
Right 916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 57
916952465_916952473 12 Left 916952465 1:169794869-169794891 CCTCACAACGCCTCCTCCGGACC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 57
916952469_916952473 -9 Left 916952469 1:169794890-169794912 CCTAAATCGCGCACCAGTGAGTC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916952473 Original CRISPR CAGTGAGTCGAGTCCTCCAG GGG Exonic
900626123 1:3609469-3609491 CTGTGAGCAGAGGCCTCCAGTGG + Intronic
901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG + Intronic
901143658 1:7051515-7051537 CTGTGAGTGGGGTCTTCCAGTGG + Intronic
901905378 1:12404952-12404974 CAGTGAGAAGAGTCCTCGACTGG - Intronic
902406668 1:16187841-16187863 CTGTGGGTTGAGTCCTCCTGAGG - Intergenic
904181251 1:28668449-28668471 AATGGAGTAGAGTCCTCCAGAGG + Intergenic
912244517 1:107946980-107947002 CAGACAGTGGTGTCCTCCAGAGG + Intronic
912921147 1:113868579-113868601 CACTGACTCATGTCCTCCAGTGG - Intronic
914804808 1:150984116-150984138 CTGTCTCTCGAGTCCTCCAGGGG - Intronic
916662831 1:166937732-166937754 CAGTCTGTCCAGGCCTCCAGGGG - Intronic
916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG + Exonic
924600270 1:245482659-245482681 CAGTGAGGTGAGTCCTCCATGGG - Intronic
1067715008 10:48684387-48684409 CAATGAGGGGAGTCCTCCTGCGG - Intergenic
1074153060 10:110775685-110775707 CAGTCAGTCCACTCCTGCAGAGG + Intronic
1079998112 11:27317954-27317976 CTGTGAGGCCAGTACTCCAGGGG - Intergenic
1081938038 11:46918265-46918287 CCGGGAGGCGAGTCCTGCAGCGG + Intronic
1084244897 11:67850348-67850370 CATTGCCTCGAGACCTCCAGAGG - Intergenic
1084793718 11:71490756-71490778 CAGGGAGTCGCTTCTTCCAGGGG - Intronic
1091918239 12:4284407-4284429 CAGTGAGCTGTGTTCTCCAGAGG + Intronic
1099313881 12:81061597-81061619 CACTGAGACGAAACCTCCAGAGG - Intronic
1104972539 12:132538464-132538486 CACTGAGTGGGGGCCTCCAGTGG + Intronic
1115449168 14:33526570-33526592 CAGTGAATAGGGTCCTCCTGGGG + Intronic
1119205344 14:72789848-72789870 CAGTGAGTGGAGTCCTAAGGAGG - Intronic
1123783639 15:23647697-23647719 GGGTGACTCGAGTCCTCCGGCGG - Exonic
1130886496 15:88096791-88096813 CAGTGAGTGGATTGCTGCAGTGG - Intronic
1132995057 16:2818421-2818443 CATTGAGCCAAGGCCTCCAGGGG - Intronic
1136136001 16:28257317-28257339 GAGTGAGTAGAGTTTTCCAGGGG - Intergenic
1142892960 17:2957164-2957186 CATTGAACCGAGGCCTCCAGGGG - Intronic
1151653047 17:75481696-75481718 CAGTGAGACGAGGCAGCCAGGGG + Intronic
1157459010 18:47868382-47868404 GAGTGAGTATAGTCATCCAGAGG + Exonic
1160844543 19:1160585-1160607 CAGTGAGCCGAGACCCCCAGTGG - Intronic
925077837 2:1033328-1033350 CAGAGAGTAGAGCCTTCCAGGGG + Intronic
926953478 2:18269489-18269511 CAGTGGCTGGAGTCCTCCTGTGG + Intronic
930167714 2:48219607-48219629 CAGTGAATCCAGTCCTGCAAAGG - Intergenic
934751521 2:96797154-96797176 CAGTGAGTCCAGCCTTCCACAGG + Exonic
941755802 2:169184451-169184473 CAGTCAGCCCAGACCTCCAGAGG - Intronic
943295298 2:186130530-186130552 CAGTGAGTCCTGTGCTCCTGTGG - Intergenic
944524403 2:200603794-200603816 CAGGGAGTTGAGGCCTCCAGAGG + Intronic
948729836 2:239955928-239955950 CTCTGTGTCGAGTCCTCCAGAGG + Intronic
948896209 2:240928982-240929004 CAGAGAGTCGTGCCCTCCAGCGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1172313696 20:33937221-33937243 CAGTGAGCCGAGTTCTACAGCGG - Intergenic
1174311714 20:49661122-49661144 TAGGAAGTCAAGTCCTCCAGGGG + Intronic
949482076 3:4503545-4503567 GAGTGATTTGTGTCCTCCAGGGG + Intronic
951161041 3:19422819-19422841 AAGTGTGTTGAGACCTCCAGTGG + Intronic
951811468 3:26705411-26705433 CAGTGAGTCGAGATTTGCAGAGG + Intronic
952057518 3:29466023-29466045 CAGTGAGTGAGGTCCTGCAGTGG - Intronic
963242350 3:143019642-143019664 CAGTAACTCATGTCCTCCAGAGG + Intronic
971045122 4:22797682-22797704 GGGTGAGTGGTGTCCTCCAGAGG + Intergenic
982579766 4:157162688-157162710 CACTGAGACGAACCCTCCAGAGG - Intronic
984160758 4:176249692-176249714 GAGTTAGACGAGTGCTCCAGAGG + Intronic
990649520 5:57882383-57882405 CAGTAAGTGGGGTCCTCAAGTGG + Intergenic
996523310 5:124450991-124451013 CAGTGAGAAGAGGCCACCAGGGG - Intergenic
997640883 5:135448239-135448261 CAGAGATTCGAGTCAGCCAGGGG + Exonic
1007052128 6:38842735-38842757 CAGTGAGTCATGTCCTCTACTGG + Exonic
1022264836 7:28743698-28743720 CAGTGGGGTGATTCCTCCAGAGG + Intronic
1027534306 7:79377418-79377440 CAATGAATCTCGTCCTCCAGCGG - Intronic
1035319133 7:158017319-158017341 CAGGGAGTCCAGTGCTCCTGAGG + Intronic
1035427466 7:158790020-158790042 CAGTGGGGAGAGTCCTCCTGGGG + Intronic
1046876704 8:119262737-119262759 TAGTGAGTGGAGTACTCAAGGGG + Intergenic
1049620465 8:143596134-143596156 CAGAGGGCCTAGTCCTCCAGAGG + Intronic
1057046977 9:91893503-91893525 CCGTGAGGCGTGTCCCCCAGTGG - Intronic
1062497713 9:136839485-136839507 CGGTAAGACGAGTCCTCCCGGGG + Exonic
1188535015 X:31187034-31187056 CAGTGAGTGGTGAACTCCAGTGG - Intronic
1192659743 X:73029740-73029762 AAGTGAGTTGATTCCTTCAGGGG - Intergenic