ID: 916952695

View in Genome Browser
Species Human (GRCh38)
Location 1:169796729-169796751
Sequence TAGATCACCTGGAACCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916952695 Original CRISPR TAGATCACCTGGAACCTTGA AGG (reversed) Intronic
900631272 1:3636906-3636928 AAGATCCCCTGGAATCTGGAAGG + Intronic
900751475 1:4400653-4400675 TGGATCACATGTAAGCTTGAGGG + Intergenic
905925956 1:41749971-41749993 TTGATCACTTGGAACCTTTCTGG + Intronic
908081755 1:60588216-60588238 TTGATCACATGGAACCATTATGG + Intergenic
910118833 1:83761657-83761679 TGGACAACCTGGAACTTTGAAGG + Intergenic
910546243 1:88422626-88422648 GAGAGCACCTAGACCCTTGAGGG + Intergenic
911674088 1:100639157-100639179 CAGATCATCTGAGACCTTGAAGG + Intergenic
913562152 1:120032244-120032266 TGGATCACAGGGAACCTTCAGGG - Intronic
913635972 1:120761350-120761372 TGGATCACAGGGAACCTTTAGGG + Intergenic
914259246 1:145985117-145985139 TAGGTCACCTGGAAGGTGGAAGG - Intergenic
914282737 1:146191632-146191654 TGGATCACAGGGAACCTTTAGGG - Intronic
914543767 1:148642348-148642370 TGGATCACAGGGAACCTTTAGGG - Intronic
914622854 1:149428661-149428683 TGGATCACAGGGAACCTTTAGGG + Intergenic
914687255 1:149991765-149991787 TAGATCCCATGGAAAATTGAGGG - Intronic
916952695 1:169796729-169796751 TAGATCACCTGGAACCTTGAAGG - Intronic
921819758 1:219604026-219604048 AAGGTCACATGGAGCCTTGAAGG + Intergenic
923224032 1:231922734-231922756 TATCTCACCTGGAACCCAGAGGG - Intronic
923946372 1:238892734-238892756 TAGAGGACCTGGGACCTGGATGG - Intergenic
1065663056 10:28026083-28026105 CAGAACACCTGGAGCCTTGGTGG - Intergenic
1070714684 10:78710762-78710784 GAAAGCACCTGGATCCTTGATGG + Intergenic
1075835466 10:125449102-125449124 TATATAACCTGGACCCTTGGAGG - Intergenic
1080760155 11:35240878-35240900 AAGATCACCTGGCACATGGATGG + Intergenic
1081468378 11:43346288-43346310 GAGATCACCTGGACACATGAAGG - Intergenic
1081839143 11:46183305-46183327 CACAGCACCTGGAATCTTGATGG - Intergenic
1084316646 11:68349606-68349628 GAGTTCACCTGGGCCCTTGAAGG + Intronic
1088435987 11:109813611-109813633 TAGATCATCTGGAAAGATGAAGG - Intergenic
1089154092 11:116387249-116387271 CAGATCACCTGGAAGCTTGTTGG + Intergenic
1093082774 12:14832199-14832221 TCGATCACATAGGACCTTGAAGG - Intronic
1094221328 12:27996862-27996884 GAAATAACCTGGATCCTTGAGGG - Intergenic
1099068325 12:78012467-78012489 TAGATTACTTAGAACCTGGAGGG - Intronic
1100066790 12:90657095-90657117 CATATCACCTGGAAGCTTTATGG + Intergenic
1101001341 12:100361235-100361257 TAGATCACAGAGGACCTTGAAGG - Intronic
1101504606 12:105334382-105334404 AATATCTCCTGGAAACTTGAAGG - Intronic
1107644462 13:42479512-42479534 CAGATCACATGGGACCTTGTGGG + Intergenic
1116495937 14:45560193-45560215 CACATCACTTGGAACCTTGTAGG + Intergenic
1118953114 14:70452915-70452937 GAGATGATCTGGAACCATGAGGG + Intronic
1119144393 14:72297614-72297636 GAGATCACCTGGACACATGAAGG - Intronic
1121450944 14:94007808-94007830 TAGCTCCCCAGGAACCCTGAGGG + Intergenic
1122809277 14:104280077-104280099 TGGATGTCCTGGAACCTGGACGG - Intergenic
1128242879 15:66113396-66113418 GATTTCACCTGGAAGCTTGAGGG + Intronic
1129795061 15:78369877-78369899 TATATCACCTGGAGCCATGGAGG - Intergenic
1133248444 16:4464545-4464567 CAGATCACCTGGGAGCTCGAGGG + Intronic
1133927056 16:10201795-10201817 TAGACCACCTGGAACAGAGAAGG - Intergenic
1134048836 16:11122732-11122754 CAGATCACCTCAAACCTTCATGG + Intronic
1134788589 16:16967443-16967465 GAGATCACCTTGACCCCTGAAGG - Intergenic
1135011592 16:18885148-18885170 TATATCAACTGTATCCTTGATGG + Exonic
1136328750 16:29554474-29554496 TATATCAACTGTATCCTTGATGG + Intergenic
1136443381 16:30294173-30294195 TATATCAACTGTATCCTTGATGG + Intergenic
1139890104 16:70246596-70246618 TATATCAACTGTATCCTTGATGG + Intergenic
1142555694 17:775343-775365 CAGCTCTCCTGCAACCTTGAGGG + Intronic
1143225783 17:5301713-5301735 TATATCACCTGAAATCTTGGTGG - Intronic
1143440521 17:6969395-6969417 TAGAGCAACTGGAACATTGCTGG + Intronic
1144099148 17:11928951-11928973 TAGATTATTTGAAACCTTGATGG - Intronic
1144377643 17:14661394-14661416 TACATCACCTGGGAGCTTGCTGG + Intergenic
1146506379 17:33409351-33409373 TAGAGCACCTGGCTCTTTGAAGG - Intronic
1149278030 17:55066794-55066816 TAGATCACCTTGAACCTGGGAGG + Intronic
1155017858 18:21863394-21863416 GAGGTCACCTGGACACTTGAAGG + Intronic
1157964788 18:52195593-52195615 ATGATCACCTTGAACATTGATGG - Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1167687019 19:50962763-50962785 TAGATCAGCAGGATCCATGAAGG - Intronic
925121990 2:1426725-1426747 TAGATCATCAGGAAACATGATGG + Intronic
926562705 2:14435061-14435083 TACATCACATGGACACTTGAAGG + Intergenic
928110960 2:28508440-28508462 TAGAGCACCTGGAATTTTAATGG + Intronic
929130517 2:38564925-38564947 TAGATTTCCTGGAACCTTTTGGG - Intronic
932426382 2:71638008-71638030 GACATCACCTGGAACTTTGAAGG + Intronic
933298213 2:80514533-80514555 GAGGTCACATGGACCCTTGAAGG + Intronic
933550925 2:83774122-83774144 GAGATCACCTGGACACATGAAGG + Intergenic
936697149 2:114964719-114964741 CAGATCACATGGAACCTTTAGGG + Intronic
939242942 2:139585381-139585403 TAGATCAACTTGAGCCTTGATGG - Intergenic
940877633 2:158914071-158914093 TTGATCAAGTGGGACCTTGATGG + Intergenic
947443844 2:230148115-230148137 GGGATCACCTGGAGGCTTGATGG + Intergenic
1170857545 20:20071030-20071052 TAGAACACCCTGAATCTTGAGGG + Intronic
1171141303 20:22745979-22746001 TACATCAGCTGGAACCTTTCTGG + Intergenic
1173536703 20:43820282-43820304 GAGATCACCTGGACACATGAAGG + Intergenic
1173553972 20:43952512-43952534 TCGACCATCTGGAACCTTGCTGG + Intronic
1173919644 20:46734029-46734051 TAGATCCTCAGGAACCTTCAGGG - Exonic
1178477021 21:32945939-32945961 TATATCAGCTGGTACCTTCAAGG + Intergenic
1178881505 21:36453800-36453822 TGGATGACCTTGAACCTGGATGG - Intergenic
1181383407 22:22525153-22525175 AGGATCACCTGGAACCTGGGAGG + Intergenic
1181915677 22:26278095-26278117 CAGATCACCAGGAACCTTCCAGG + Intronic
1185306263 22:50118801-50118823 GAGATCAGCTGGAACCAAGATGG - Intronic
950577185 3:13839208-13839230 CACATCACCTGGAAACTTGTCGG + Intronic
953839130 3:46374691-46374713 TAGATCATGAAGAACCTTGACGG + Exonic
954896712 3:53981333-53981355 TATACTACCTGGAACCCTGATGG + Intergenic
955655371 3:61239899-61239921 TATATCACCTGGCAGCTTGTTGG + Intronic
956485618 3:69719098-69719120 TAAATCACCTGGAAGCCCGAGGG + Intergenic
957686760 3:83512560-83512582 TAGATCCCCAGGGACATTGAAGG + Intergenic
958866698 3:99509238-99509260 TAGACCACCAGAAACCTTAAAGG + Intergenic
959845201 3:111024536-111024558 GAGATCACCTGGACACATGAAGG + Intergenic
960255821 3:115510512-115510534 AACATCACCTGGAAGCTTGCTGG - Intergenic
960546453 3:118920061-118920083 GAGATCACCTGGACACATGAAGG + Intronic
961229906 3:125295682-125295704 TTGCTCACCTGTAACCTGGAGGG + Intronic
961620390 3:128219388-128219410 TGGGTCACCAGGAGCCTTGAAGG - Intronic
962584825 3:136831607-136831629 TAGGTCACCAGGAAAGTTGAAGG + Intronic
964083966 3:152793839-152793861 TAGACCACCTGGTCACTTGATGG + Intergenic
964217609 3:154304418-154304440 TATACTACCTGGAACATTGAAGG + Intronic
964450924 3:156812521-156812543 TAAATCTCCTGGCACTTTGAAGG - Intergenic
965285743 3:166817581-166817603 TAGATCACCTAGGACATTGTAGG - Intergenic
966798376 3:183738592-183738614 GAGATCACCTGGACACATGAAGG - Intronic
971849581 4:31966953-31966975 GAGATCACCTGGACACATGAAGG - Intergenic
974830511 4:67182851-67182873 GAGATCACCTGGACACATGAAGG + Intergenic
976181794 4:82406270-82406292 TAGATCAACTGGTACATAGATGG + Intergenic
976316440 4:83663924-83663946 TATATCACAAGGAACATTGAGGG - Intergenic
977836440 4:101650915-101650937 CAGGTCACCTGGGACATTGAAGG + Intronic
979320598 4:119319624-119319646 TAGGGGACCTGGAGCCTTGAGGG - Exonic
979721463 4:123905240-123905262 TAGATCCTCTGGAATCTAGATGG - Intergenic
979751257 4:124281886-124281908 GAGATCACCTGGACACATGAAGG + Intergenic
981314674 4:143330526-143330548 TGGATCTGCTGGTACCTTGATGG + Intergenic
981497691 4:145412120-145412142 TGGATCACCTGGGACCCTGTAGG - Intergenic
983602353 4:169545243-169545265 GAGATCACCTGGACACATGAAGG - Intronic
983642892 4:169959963-169959985 TTGATCATCTTGAACATTGAAGG + Intergenic
985336609 4:188904461-188904483 TAAAACACCTGGCACCTGGAGGG + Intergenic
986303998 5:6501934-6501956 TAGACCACCTGGACACCTGAGGG - Intergenic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
988812210 5:34796772-34796794 CAGTTCACCTGGGAACTTGAAGG + Intronic
989280876 5:39641961-39641983 TGTACCACCTGGAACCTTAATGG - Intergenic
990158341 5:52905718-52905740 TATACCACCTGGACCCTTAAAGG - Intronic
990970857 5:61504311-61504333 TAGATTACCTGCAGCATTGATGG - Intronic
994188936 5:96846094-96846116 GAGATCTCCAGGAACCTTGTAGG + Intronic
996689836 5:126328579-126328601 TATATCATATGGAAACTTGAAGG - Intergenic
996807838 5:127477742-127477764 GAGATCACCTGGACACATGAAGG + Intergenic
999617710 5:153442618-153442640 TAAATCACCAGGAATTTTGATGG + Intergenic
1002803417 6:548922-548944 TAAACCAGCTGTAACCTTGAGGG + Intronic
1003760884 6:9177497-9177519 AAGAGCACCTGGCACCTGGATGG - Intergenic
1003909190 6:10727925-10727947 CAGACCACATGGAGCCTTGAAGG - Intronic
1004727854 6:18327892-18327914 TAGCTCACCTGGAGTTTTGAAGG + Intergenic
1009565881 6:65310565-65310587 AAGGTCACATGGAGCCTTGAAGG - Intronic
1020942380 7:14557036-14557058 AGGATCACCTGGAAGCTTGTTGG + Intronic
1022884455 7:34628416-34628438 TAGAGCAGCTGGAACATTGTAGG - Intergenic
1022948996 7:35317558-35317580 TAGAACACCTGGCACATGGATGG - Intergenic
1023392799 7:39726574-39726596 TGGGTCACCTGCAACCCTGAGGG - Intergenic
1026249124 7:68651922-68651944 GAGATCACCTGGACACATGAAGG - Intergenic
1027830706 7:83173725-83173747 AAGATCACATGGAACTTTGTAGG - Intergenic
1028182029 7:87735391-87735413 AAGATCAGCTGGAAGCTAGATGG - Intronic
1029468342 7:100740185-100740207 CAGATCACATAGAGCCTTGAAGG + Intronic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1032415028 7:131729278-131729300 TAAATGGCCTGGCACCTTGAGGG + Intergenic
1033197000 7:139336353-139336375 TAGATCACATAGAACCTCCAAGG - Intergenic
1037934008 8:22902424-22902446 TGGATCACCTGGTAGCTTTATGG + Intronic
1041679737 8:60576728-60576750 GAGAGGACCTGGAACCCTGAGGG + Intronic
1041748139 8:61231668-61231690 AGGATCACCTGGAAACTTGCCGG + Intronic
1042141914 8:65687753-65687775 TATATCACCTGGGAAGTTGATGG + Intronic
1043056675 8:75448234-75448256 GAGATCACCTGGACACATGAAGG + Intronic
1043603385 8:81969336-81969358 CAGATCACATGGAACCTTGGAGG - Intergenic
1046326360 8:112652339-112652361 TATATCACCTGGAACATTGGGGG - Intronic
1046930352 8:119835901-119835923 TAGATCACGTAGAACCTTGAAGG + Intronic
1047982837 8:130201019-130201041 AATATCACCTGGAAACTTGTTGG + Intronic
1055274325 9:74597123-74597145 TGCATCACCTGGGAGCTTGAAGG - Intronic
1055664059 9:78535723-78535745 GAGATCACCTGGACACATGAAGG + Intergenic
1057518880 9:95745001-95745023 TAAATCACCTGGATCGTTTAAGG - Intergenic
1059043897 9:110843561-110843583 TGGATCTCCTGGAACCTAGATGG + Intergenic
1059896545 9:118872586-118872608 TGGGTCACATAGAACCTTGAAGG - Intergenic
1061182386 9:129032438-129032460 GAGGTCACCTGGACACTTGAAGG - Intergenic
1061403980 9:130383586-130383608 CAGCTCACCTTGAACCCTGAGGG - Intronic
1188253394 X:27928167-27928189 GAGATCACCTGGACACATGAAGG + Intergenic
1189268574 X:39734904-39734926 TCAATCACCTAGAAGCTTGAAGG - Intergenic
1201422734 Y:13818137-13818159 CAGATTACCTGGGACCTTGTTGG - Intergenic