ID: 916959748

View in Genome Browser
Species Human (GRCh38)
Location 1:169877105-169877127
Sequence CACTGAAATGATTTTTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 4, 3: 20, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916959748 Original CRISPR CACTGAAATGATTTTTGGTT TGG (reversed) Intronic