ID: 916959915

View in Genome Browser
Species Human (GRCh38)
Location 1:169878937-169878959
Sequence TAGTGGGTAGGGAGGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 882
Summary {0: 1, 1: 0, 2: 2, 3: 80, 4: 799}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916959915_916959920 -9 Left 916959915 1:169878937-169878959 CCTACCTTCCTCCCTACCCACTA 0: 1
1: 0
2: 2
3: 80
4: 799
Right 916959920 1:169878951-169878973 TACCCACTATATTTCACATAAGG 0: 1
1: 0
2: 0
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916959915 Original CRISPR TAGTGGGTAGGGAGGAAGGT AGG (reversed) Intronic
900099579 1:955881-955903 AGGGGGGTAGGGTGGAAGGTGGG - Intronic
902142740 1:14370265-14370287 TCCTGGGTAGGGTGGAGGGTGGG + Intergenic
902322177 1:15675747-15675769 CAGTAGGTAGGTAGGTAGGTAGG - Intergenic
903331756 1:22600195-22600217 AAGGAGGGAGGGAGGAAGGTGGG + Intronic
904068525 1:27773778-27773800 AGGTGGGTGGGGAGGAAGGTGGG - Intronic
904197532 1:28796884-28796906 GAGTTGGGAGGGAGAAAGGTGGG + Intergenic
904212902 1:28897547-28897569 AGGTAGGTAGGTAGGAAGGTAGG + Intronic
904395623 1:30219575-30219597 TAGTGGGGAGGGAGGCAGTGAGG + Intergenic
904566755 1:31432943-31432965 TGCAGGGGAGGGAGGAAGGTGGG - Intronic
904853023 1:33473245-33473267 CAGTGGGTAAGTAGGTAGGTAGG - Intronic
904921511 1:34011852-34011874 GAGTGGGGAGGGAGGAGGGGAGG - Intronic
905011702 1:34751546-34751568 AGGTGGGAAGGGTGGAAGGTGGG - Intronic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
905930570 1:41784027-41784049 GAGTAGGTAGGGAAGAAGGATGG + Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906694847 1:47817096-47817118 AAGTGGGAAGGAAGGAAGGAGGG + Intronic
906746366 1:48224835-48224857 TAGTGGGGAGGAAGAAAGTTGGG - Intronic
906944783 1:50286428-50286450 CAGTGGGTAGAGTGGAAGGTAGG - Intergenic
907077989 1:51595333-51595355 TAGAGGGAAGGGAGGATGGAGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907623019 1:56001302-56001324 AAGTGGGTAAGAAGGAAGGAAGG + Intergenic
908418889 1:63939970-63939992 GAGTGGGAAGGGAGGAAGTTAGG + Intronic
908540910 1:65121212-65121234 TAGTAGGTGGGTAGGAAGGTAGG - Intergenic
908563887 1:65334710-65334732 TAGTGGGTGTGTAGAAAGGTGGG + Intronic
909618401 1:77639061-77639083 TGGTCGGTAGGTAGGTAGGTAGG + Intronic
909734686 1:78942542-78942564 AAGTTGGTAGTGAGGAAAGTGGG - Intronic
910003217 1:82361893-82361915 TTGTGGCTAGGGAGAAAGGTGGG - Intergenic
910030772 1:82719967-82719989 TAGGGGGTTGGGAGGGAGGTGGG - Intergenic
910537295 1:88312968-88312990 TTGTAGGTAGGTAGGTAGGTAGG + Intergenic
911141216 1:94504437-94504459 TTGTGGCTAGGGATGAGGGTAGG + Intronic
911197967 1:95015075-95015097 TAGTGGGTTGGGAGCAAGTCAGG + Intronic
911276418 1:95864977-95864999 TTGTGGGGAGAGAGGAAGGGAGG - Intergenic
911564785 1:99450968-99450990 TAGTGGGTGGGGAGGAAGTGGGG + Intergenic
911566844 1:99472312-99472334 TAGAGGGCAGGGAGGCAGGGAGG + Intergenic
912643118 1:111366492-111366514 TGCATGGTAGGGAGGAAGGTTGG - Intergenic
913191313 1:116415771-116415793 CAGTGGGGAGCGAGGATGGTGGG + Intergenic
914353773 1:146863412-146863434 TAGGGGGAGGGGAGGAAGGGAGG - Intergenic
914702486 1:150147875-150147897 TACTGGGAAAGGAGGAAGATGGG + Intergenic
914728948 1:150353454-150353476 AAGTGGTAAGGGAGGAAGGAGGG + Intergenic
915288517 1:154867944-154867966 GAGTGGAGATGGAGGAAGGTGGG - Intronic
915564564 1:156706401-156706423 TAGGGGGAAGGGAGGGAGGCGGG + Intergenic
915699124 1:157773939-157773961 TAGGGGGCAGGGAGAAGGGTAGG + Intronic
915703276 1:157818503-157818525 TAGTGGGGAAGGAGGAATGAGGG + Intronic
915932348 1:160068464-160068486 TGGTGGCAAGGGAGGAAGGGAGG - Intronic
916025737 1:160831838-160831860 TAATGGGTAGTGGGGGAGGTTGG + Intronic
916146369 1:161743830-161743852 TAATGGGTGGGGATGAAGGGAGG - Intergenic
916277090 1:163006817-163006839 GAGAGGGTAGGAAGGAAGATTGG - Intergenic
916417213 1:164603068-164603090 GAGTGGGTATGGAAGAAGGAAGG - Intronic
916959915 1:169878937-169878959 TAGTGGGTAGGGAGGAAGGTAGG - Intronic
917313787 1:173704050-173704072 TAGTGGCAAGGCAGGAAAGTGGG + Intergenic
917407004 1:174717954-174717976 TCTTGGGTAGGGAGGCAGATGGG + Intronic
917482901 1:175427795-175427817 AAGAGGGAAGGGAGGAAGGAAGG - Intronic
918073692 1:181153001-181153023 GAGTGGGTGGAGAGGAAGGCGGG - Intergenic
918095542 1:181330959-181330981 TTGTGGGAAGGGAGGAGGGCAGG + Intergenic
918576197 1:186063405-186063427 GAGTGGGGAGGGAGAAAGGAAGG + Intronic
919051193 1:192513410-192513432 CAGTGGGAAGGAAGGAAGGAAGG + Intergenic
919490281 1:198197949-198197971 TGGTGGGTATGGAGGAGGGTAGG + Intronic
919509748 1:198447583-198447605 AAGGAGGGAGGGAGGAAGGTAGG - Intergenic
919639581 1:200035541-200035563 GAGGGGGTGGGGAGGAAGGCAGG + Intronic
919910375 1:202107244-202107266 TAGTGGGGATAGGGGAAGGTTGG - Intergenic
919986072 1:202676167-202676189 TGGGGGGAAGGGAGGAAGATGGG - Intronic
920323715 1:205144767-205144789 CAGTGGGGAGGGTGGAAGGGAGG - Exonic
920574899 1:207052330-207052352 TAGGGGGTAGGTAGGAGGGAAGG + Intronic
920692542 1:208158066-208158088 AAGTGGGAAAGAAGGAAGGTAGG + Intronic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
922000259 1:221470140-221470162 AGGTGGGTAGGGAGCAAGGAGGG + Intergenic
922613180 1:226944806-226944828 TAGAAGGGAGGCAGGAAGGTAGG + Intronic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
923433906 1:233950480-233950502 AAGTGGGGAGGGAGAAAGGAAGG - Intronic
924099096 1:240585211-240585233 TAGTGTGAAGGAAGGAAGGAAGG + Intronic
924154190 1:241159291-241159313 TAGTGTGTAGGAAGACAGGTGGG - Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063349155 10:5338297-5338319 TAGAAGGAAGGAAGGAAGGTGGG - Intergenic
1063625123 10:7681914-7681936 AAGAAGGTAGGAAGGAAGGTAGG + Intergenic
1064402581 10:15033937-15033959 TAGCAGGTAGGGAGAAAGGAAGG + Intronic
1064482795 10:15756489-15756511 CAGTGGGTCGGGGGGAAGGGGGG + Intergenic
1064589392 10:16873096-16873118 TAGAGGGGAGGTAGGTAGGTAGG + Intronic
1065232780 10:23615599-23615621 GAGTGGGGAGGGTGGAAGGAGGG - Intergenic
1065383940 10:25115401-25115423 AAGGGGGGAGGGAGGAAGGAAGG - Intergenic
1066004282 10:31133054-31133076 TCCTGGGGAGGGAGGAAGGGAGG - Intergenic
1066131740 10:32401099-32401121 TAATGGGAAGGAAGGAAGGAAGG - Intergenic
1066298221 10:34074763-34074785 AAGTGGGGAGGAAGGAAGGCAGG + Intergenic
1067143756 10:43678704-43678726 TGGTGGGCAGGGAAGATGGTGGG - Intergenic
1067481019 10:46597753-46597775 GAGGGGGAAGGGAGGAAGGAAGG - Intergenic
1067613732 10:47744069-47744091 GAGGGGGAAGGGAGGAAGGAAGG + Intergenic
1067879979 10:50034791-50034813 GAGGGGGAAGGAAGGAAGGTAGG + Intergenic
1067891904 10:50144589-50144611 GAGGGGGAAGGAAGGAAGGTAGG - Intergenic
1067979815 10:51073222-51073244 GAGTGGGCAGGGATGAGGGTGGG + Intronic
1068168341 10:53360072-53360094 TAGGGGATTGGGAGGGAGGTGGG - Intergenic
1068498342 10:57813951-57813973 GAGTGGGGAAGGTGGAAGGTGGG - Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1070129382 10:73646552-73646574 TAGAGAGTGAGGAGGAAGGTGGG + Exonic
1070208718 10:74292110-74292132 AAGTAGGTAGGTAGGCAGGTAGG - Intronic
1070537748 10:77392200-77392222 CAGTGGGGAGGAAGGAAGGAAGG + Intronic
1070577350 10:77689266-77689288 AGGTGGGAAGGGAGGAAGGGAGG - Intergenic
1071629143 10:87204041-87204063 GAGGGGGAAGGGAGGAAGGAAGG + Intergenic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1072473709 10:95738032-95738054 TTCTGGGTAGGGAGAAAGGAAGG + Intronic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1073711252 10:106045318-106045340 TAGTGGGTGGGGTGGGGGGTGGG + Intergenic
1073953736 10:108842568-108842590 TAGTAGGTAGGTAGGTAGGTAGG + Intergenic
1074392659 10:113071157-113071179 AAGCGGGTAGGGAGGCAGGGTGG - Intronic
1074761388 10:116669811-116669833 AGGTGGGCAGGGAGGAGGGTGGG + Intronic
1074910966 10:117908482-117908504 TTATGGGGAGGGAGGAAGGGAGG - Intergenic
1075730351 10:124631971-124631993 CAGAGGGTAGGTAGGAAGGAAGG + Intronic
1076088373 10:127656490-127656512 TAGTGGGCTGGGAGGAAGGGGGG - Intergenic
1076245422 10:128943700-128943722 AAGTGGGTAGAGAGGAGGGCTGG + Intergenic
1076323282 10:129599972-129599994 AAGTAGGTAGGTAGGTAGGTAGG + Intronic
1076421592 10:130335863-130335885 TGGTGGGTAGGGAGGGAGACAGG + Intergenic
1076428418 10:130383835-130383857 TAGTTGGTAGGTTGGTAGGTAGG - Intergenic
1076444125 10:130500318-130500340 GAGATGGAAGGGAGGAAGGTGGG - Intergenic
1076533153 10:131159000-131159022 AAGTGGGTGGGAAGGATGGTGGG - Intronic
1077061583 11:620012-620034 GAGGGGGAAGGGTGGAAGGTAGG - Intronic
1077297804 11:1834279-1834301 ATGTGGGTGGGAAGGAAGGTGGG - Intronic
1077353980 11:2106274-2106296 TGGTGGATAGGGAGGAAGCATGG - Intergenic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077572568 11:3352693-3352715 TAGGGGGAAGGCTGGAAGGTAGG + Intronic
1077992699 11:7426141-7426163 TAGCTGGGAGGGAGGAAGGAAGG - Intronic
1078135989 11:8652142-8652164 TATGGGGCAGGGAGGAAGGTAGG - Intronic
1078215856 11:9311441-9311463 CGGTGGGTATGGAGGAGGGTAGG + Intronic
1078350143 11:10586196-10586218 TTGTGGGTAGGGTGGCAAGTGGG + Intronic
1078579100 11:12525145-12525167 GAGTGGGAAGGTAGGCAGGTCGG + Intronic
1078872975 11:15366148-15366170 TGATGGGCAGGGAGGAAGCTGGG + Intergenic
1080557388 11:33430038-33430060 GAGAGGGAAGGGAGGAAGGAAGG - Intergenic
1081430390 11:42970244-42970266 TAGTGGGTAGGGAGGATCAATGG - Intergenic
1081655824 11:44856833-44856855 AAGTGTGTAGGGAGGGAGGGAGG - Intronic
1081692846 11:45089733-45089755 TGGAGGGAAGAGAGGAAGGTAGG - Intergenic
1081811440 11:45916428-45916450 AAGTGGGTGGAGAAGAAGGTTGG - Intronic
1081877533 11:46419808-46419830 AGGTGGGGAGGGAGGAAGGCAGG + Intronic
1081997863 11:47376651-47376673 CAGGGAGGAGGGAGGAAGGTGGG - Intronic
1082093547 11:48108791-48108813 TTGATGGTAGGGTGGAAGGTGGG + Intronic
1082861696 11:57863287-57863309 TAGTAGGTAGGTAGGTAGTTAGG + Intergenic
1082892489 11:58155016-58155038 AGGTAGGTAGGCAGGAAGGTAGG - Intronic
1084070402 11:66729659-66729681 AAATGGGTTGGGAGGAGGGTTGG + Intergenic
1084172063 11:67405572-67405594 CTGTGGGTAGCCAGGAAGGTGGG - Intronic
1084178908 11:67437106-67437128 TGGTGGGGAGGGAGGAAGAGGGG - Intronic
1084774149 11:71364499-71364521 GAGTGGGTAGGGTGGATGGATGG + Intergenic
1084906773 11:72354593-72354615 TGGGAGGGAGGGAGGAAGGTGGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085445506 11:76598274-76598296 AAGTGGGCAGGCAGGCAGGTGGG - Intergenic
1085449771 11:76624831-76624853 AAGCGGGTGGGGAGGAAGGTGGG + Intergenic
1085464261 11:76713459-76713481 TGGTGGGTAGGCAGGTAGATGGG + Intergenic
1085486943 11:76872425-76872447 AAGTGGTAAGGGAGGAAGGCAGG - Intronic
1086496104 11:87405953-87405975 TTTTGGATATGGAGGAAGGTAGG + Intergenic
1086541907 11:87922892-87922914 AAGGGGGAAGGGAGGAAGGGAGG + Intergenic
1087624372 11:100580239-100580261 GGGTGTGTAGGGAAGAAGGTAGG - Intergenic
1087671359 11:101111220-101111242 GAGAGGCTAGGGAGGGAGGTTGG - Intronic
1087899120 11:103620915-103620937 TAGTGGGTGGGGAAATAGGTGGG + Intergenic
1088158797 11:106842717-106842739 AAGGGGGTAGGGAGGAATGAAGG + Intronic
1088653037 11:111975144-111975166 TAGTAGGAGGGTAGGAAGGTAGG + Exonic
1088878494 11:113955415-113955437 TGGTAGATAGGGAGGTAGGTAGG + Intergenic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089739095 11:120569798-120569820 TGGTGGGTGGGGAGCTAGGTAGG + Intronic
1090240481 11:125177936-125177958 TAGGGAGTAGGAAGGAAGGGAGG + Intronic
1090306208 11:125693382-125693404 AAGTGGGTAGGGGAGAAGGAGGG - Intergenic
1090336830 11:125974339-125974361 TTGTAGGTAGGTAGGTAGGTAGG + Intronic
1091389616 12:118009-118031 AAGTGGGGAGGGAGGGAGCTGGG + Intronic
1091597325 12:1886831-1886853 TAGAGGGAAGGGAGGAATGCTGG + Intronic
1091637266 12:2206586-2206608 CAGTGAGTAGGTAGGGAGGTGGG - Intronic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1092846492 12:12589698-12589720 TAGTGGGTTGTGCGGAAGGAAGG + Intergenic
1092846502 12:12589734-12589756 TGGTGGGTTGTGTGGAAGGTTGG + Intergenic
1092846570 12:12590006-12590028 TGGTGGGTTGTGTGGAAGGTTGG + Intergenic
1092846601 12:12590134-12590156 TGGTGGGTTGTGTGGAAGGTTGG + Intergenic
1092846641 12:12590298-12590320 TGGTGGGTTGTGTGGAAGGTTGG + Intergenic
1092890298 12:12963575-12963597 TACTGGGTGGGGTGGAAGGTAGG + Intergenic
1093072884 12:14724780-14724802 TGGTAGGAAGGTAGGAAGGTAGG - Intergenic
1093709536 12:22314205-22314227 TAGTGAGCATGGAGGAAGGAGGG - Intronic
1094101860 12:26773132-26773154 TAGATGGTAGGTGGGAAGGTAGG - Intronic
1096519244 12:52174831-52174853 GGGTGTGTAGGGAGGCAGGTGGG + Intronic
1096709315 12:53443598-53443620 CGGTGGGTATGGAGGAGGGTAGG - Exonic
1096790327 12:54040377-54040399 TGGTGGGAAGGGAGGGAGGGAGG - Intronic
1097704530 12:62853889-62853911 TATTGGGAAGAGAGGTAGGTAGG + Intronic
1099169716 12:79349108-79349130 CAGGAGGAAGGGAGGAAGGTAGG + Intronic
1099182736 12:79486360-79486382 TAGTGGGTGGGGATGAAGAGCGG - Intergenic
1099325049 12:81204349-81204371 GAGGGGGGAGGGAGGAAGGGAGG - Intronic
1100081391 12:90855595-90855617 TAGTTGGAAGGAAGGAAGGAAGG + Intergenic
1100137106 12:91566976-91566998 AGGTGGGAAGGAAGGAAGGTGGG - Intergenic
1100877236 12:98975169-98975191 AAGAGGAAAGGGAGGAAGGTGGG - Intronic
1101064144 12:101002023-101002045 TGGTGGGCAGCGAGGAAGATGGG - Intronic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101682558 12:106983965-106983987 AGGTGGGTATGGAGGTAGGTGGG - Intronic
1102703610 12:114862128-114862150 TAGTGGGGAGGGTGAAAGGGGGG + Intergenic
1102764818 12:115423279-115423301 GAGTGGGGAGGGAGGCAGGGAGG + Intergenic
1103439861 12:120955091-120955113 TAGTGACTTTGGAGGAAGGTGGG - Intergenic
1103908467 12:124339383-124339405 TGGTAGGTAGGTAGGTAGGTAGG - Intronic
1104814752 12:131639321-131639343 TAGAGAGTAGGCAGGAAGGGAGG + Intergenic
1104841002 12:131825651-131825673 AAGAGGGGAGGGAGGAAGGAAGG - Intergenic
1104975684 12:132551009-132551031 CAGCGGGTAGGGAGGAGGGCTGG - Intronic
1105886877 13:24649880-24649902 GAGGAGGTAGGGAGGAAGGGTGG - Intergenic
1106073833 13:26440398-26440420 GAGTGGGTAGGGAGAGATGTAGG + Intergenic
1106147585 13:27063838-27063860 TGGGGGGAAGGGAGGAAGGGAGG + Intergenic
1106153288 13:27126925-27126947 TAGTTGGGATGGAGGAAGATGGG - Intronic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1107203936 13:37757909-37757931 TGGTGGGTAGGGTTCAAGGTTGG + Intronic
1107221370 13:37985174-37985196 GAGTGGGAAGGAAGGAAGGAAGG + Intergenic
1107280697 13:38730636-38730658 TAATAGGTTTGGAGGAAGGTGGG - Intronic
1107456913 13:40563595-40563617 TCTTGGGTGTGGAGGAAGGTGGG - Intronic
1107796693 13:44060494-44060516 TAGGGAGTAGGGAGAAATGTTGG + Intergenic
1108048393 13:46404894-46404916 GAGGGGGGAGGGAGGAAGGAAGG + Intronic
1109268642 13:60229456-60229478 TGATGGGGAGGGAGGAGGGTAGG - Intergenic
1109690992 13:65888561-65888583 TAGTGATAAGGGAGTAAGGTTGG + Intergenic
1109974667 13:69815553-69815575 AACTGGGGAGGGAGGAAAGTGGG + Intronic
1112206009 13:97324089-97324111 TTGAGAGTGGGGAGGAAGGTGGG - Intronic
1112381751 13:98897419-98897441 TAGTGGGGAGGGAGGAACAGGGG - Intronic
1112786929 13:102961409-102961431 AGGTAGGTAGGTAGGAAGGTAGG - Intergenic
1113348204 13:109501885-109501907 CAGTAGGTAGGTAGGTAGGTAGG - Intergenic
1114390118 14:22298472-22298494 ATGTGGGAAGGGAGGAAGTTGGG - Intergenic
1114647591 14:24264187-24264209 TAGTGGGAAGGAAGGAAAGAAGG - Intronic
1114811828 14:25909796-25909818 AAGTAAGTAGGTAGGAAGGTAGG + Intergenic
1114811829 14:25909800-25909822 AAGTAGGTAGGAAGGTAGGTAGG + Intergenic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1115409240 14:33053796-33053818 TTTTGGGTAGAGAGGAAGGGGGG - Intronic
1116201902 14:41808193-41808215 TAGAGGGAAGGAAGGAAGGAAGG + Intronic
1116338125 14:43685835-43685857 AGGTGGGTAGGTAGGTAGGTAGG + Intergenic
1116340750 14:43720907-43720929 GAGAAGGTAGGGAGGAAGGAAGG - Intergenic
1116520720 14:45843546-45843568 TAGTAGGTAGGTAGGTAAGTAGG + Intergenic
1116581231 14:46644470-46644492 TAGTAAGTAGGCAGGTAGGTAGG + Intergenic
1116874714 14:50099492-50099514 TAATGGGTAGGCAGGAGGGCAGG - Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117531140 14:56661562-56661584 AAGAGGGAAGGGAGGAAGGGAGG + Intronic
1118072463 14:62260828-62260850 AGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1118469386 14:66061063-66061085 GGGTGGGTAGGTAGGTAGGTAGG + Intergenic
1119015335 14:71045677-71045699 TAATGCGTAGGGAGGAAGAAAGG + Intronic
1119362752 14:74065009-74065031 TAGAGGATAGGGTAGAAGGTGGG - Exonic
1119542622 14:75450743-75450765 GCGTGGTTAGGGAGGAAGGGAGG - Intronic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1120414936 14:84207471-84207493 AAGGGGGAAGGGAGGAAGGGAGG - Intergenic
1120440090 14:84525669-84525691 TAGTAGGTAGGTAGGTTGGTAGG + Intergenic
1121659451 14:95624163-95624185 GAGTGGGAAGGAAGGAAGGAAGG + Intergenic
1122020092 14:98830601-98830623 TACTGGGGAGAGAGGATGGTTGG - Intergenic
1122070849 14:99204451-99204473 TAGGGGGGAGGGAGGCAGGCAGG + Intronic
1122230631 14:100304948-100304970 TAGTGGGTGGGGAGCAAGGGTGG + Intronic
1123910600 15:24963079-24963101 TAGTGGGGAGAGAGGAAGGGAGG + Intronic
1124087141 15:26561417-26561439 TAGTGGGCAGGGGGGTGGGTGGG - Intronic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1124785967 15:32680794-32680816 TAGTGGGTAGGAAAGTGGGTGGG - Intronic
1124881492 15:33646792-33646814 TTGTGGGCAGCAAGGAAGGTAGG - Intronic
1124918861 15:34004681-34004703 TAGTGGGTGGAGAGGAATGGTGG + Intronic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125790017 15:42358079-42358101 TAGAGGCTATGGAAGAAGGTGGG - Intergenic
1126029665 15:44483781-44483803 TAGAGGGTGGGGATAAAGGTGGG - Intronic
1126942635 15:53783024-53783046 AAGTGGGGAGGAAAGAAGGTTGG - Intergenic
1127553817 15:60067464-60067486 AAGTAGGTAGGTAGGTAGGTAGG + Intergenic
1127559085 15:60118100-60118122 GTGTGGGTGGGGAGGTAGGTGGG + Intergenic
1127591264 15:60425862-60425884 TAGGAGGTAGGGAAGAAGATGGG + Intronic
1127734649 15:61829626-61829648 TAGGGCGTAGGGAGGAAGCAGGG + Intergenic
1127855568 15:62950798-62950820 GTGTGGGTAGGGATGTAGGTAGG + Intergenic
1127959796 15:63882314-63882336 TACTGGGTAAGGAGAAAGGAGGG + Intergenic
1128307392 15:66608537-66608559 GAGTGGGGAGGGAGGAGGGAAGG + Intronic
1129119506 15:73387418-73387440 TAGAGGGTGGGAGGGAAGGTAGG + Intergenic
1129141426 15:73601694-73601716 TAGTGGGTGGAGACGATGGTGGG - Intronic
1129196708 15:73972867-73972889 GTGGGGGTAGAGAGGAAGGTGGG - Intergenic
1129203065 15:74017289-74017311 AATTGGCTAGGGAGGAGGGTAGG - Intronic
1129293053 15:74583352-74583374 GAGTGGGTAGGGTGGAGGGATGG + Intronic
1129384091 15:75185978-75186000 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1129895858 15:79105334-79105356 TGGTGGGCAGGGAGGCAGGTGGG + Intergenic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1130150396 15:81307235-81307257 TACTGGACAGGGAGGCAGGTGGG + Intronic
1130239372 15:82171715-82171737 TAGAGAGTGGGGAGGGAGGTTGG + Intronic
1130338185 15:82975720-82975742 TAGTGGCATGGTAGGAAGGTGGG + Intronic
1130433747 15:83875192-83875214 GAGAGGGAAGGAAGGAAGGTTGG + Intronic
1131793316 15:95988340-95988362 AAGTAGGAAGGGAGGAAGGAAGG + Intergenic
1133033572 16:3022819-3022841 TTGTGGGGAAGAAGGAAGGTGGG + Exonic
1133163381 16:3927993-3928015 TTGTAGGTAGGTAGGTAGGTAGG - Intergenic
1133675564 16:8068229-8068251 TGGATGGTTGGGAGGAAGGTGGG - Intergenic
1134024907 16:10946188-10946210 TAATGGGAAAGGAGGAAGATAGG + Intronic
1134357037 16:13492048-13492070 AGGTGGGTAGGGACAAAGGTGGG - Intergenic
1134599806 16:15524429-15524451 TGGGAGGTGGGGAGGAAGGTGGG + Intronic
1134976950 16:18578309-18578331 TAGAGGCTAGGAAGGAAAGTGGG + Intergenic
1135024642 16:18989625-18989647 TAGTGGCGAAGGAGGCAGGTAGG + Intronic
1135315431 16:21440932-21440954 TAGTGGCGAAGGAGGCAGGTAGG - Intronic
1135368357 16:21873200-21873222 TAGTGGCGAAGGAGGCAGGTAGG - Intronic
1135443460 16:22497949-22497971 TAGTGGCGAAGGAGGCAGGTAGG + Intronic
1135449259 16:22543414-22543436 TAGTGGCGAAGGAGGCAGGTAGG + Intergenic
1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG + Intronic
1136312101 16:29419591-29419613 TAGTGGCGAAGGAGGCAGGTAGG - Intergenic
1136325540 16:29521388-29521410 TAGTGGCGAAGGAGGCAGGTAGG - Intergenic
1136383159 16:29906452-29906474 AAGGAGGTAGGGAGGATGGTGGG + Exonic
1136440229 16:30261370-30261392 TAGTGGCGAAGGAGGCAGGTAGG - Intergenic
1137862921 16:51864904-51864926 AAGTGGGAGGGGAGGAGGGTAGG + Intergenic
1137871519 16:51954564-51954586 TCGGGGGGAGGGAGGAAGGGAGG - Intergenic
1138414145 16:56861604-56861626 AAGTGGGTAGGGAGGCCTGTGGG + Intergenic
1138926123 16:61593280-61593302 TGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1138962946 16:62049499-62049521 TTGTTGGTGGGGAGGAAGGCAGG - Intergenic
1139139689 16:64246202-64246224 AAGTGTGGAGGGAGGAAGGAGGG + Intergenic
1139886726 16:70213652-70213674 TAGTGGTGAAGGAGGTAGGTAGG - Intergenic
1139918204 16:70441006-70441028 TAATGTGGAGGGAGGAGGGTGGG - Intergenic
1139980247 16:70852109-70852131 TAGGGGGAGGGGAGGAAGGGAGG + Intronic
1140575534 16:76163781-76163803 TGGTAGGTAGGTAGGCAGGTAGG - Intergenic
1140615563 16:76658343-76658365 GAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1141103663 16:81215802-81215824 AGGTGGGCAGGCAGGAAGGTGGG + Intergenic
1141371476 16:83490455-83490477 TCCTGGGAAGGGAGGAGGGTGGG - Intronic
1141380599 16:83573193-83573215 GGGGAGGTAGGGAGGAAGGTTGG + Intronic
1142130420 16:88429430-88429452 TAGTGGGTGGGGAGGGAGTGGGG - Exonic
1142223562 16:88866609-88866631 TAGAGGGGCAGGAGGAAGGTGGG + Exonic
1142246425 16:88972209-88972231 TACTGGGGAGGGAGGGAGGGAGG + Intronic
1142836879 17:2593910-2593932 GAGAGGGGAGGGAGGAAGGAGGG - Exonic
1143565040 17:7716085-7716107 TAGGGGGAAGGGACGAAGGCGGG - Intergenic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1145300608 17:21633233-21633255 TAGTAGGTAGGAAGGAAGGAAGG + Intergenic
1145349685 17:22070008-22070030 TAGTAGGTAGGAAGGAAGGAAGG - Intergenic
1145721581 17:27078147-27078169 AAGTGGCCAGGGAGGTAGGTAGG - Intergenic
1145925625 17:28644855-28644877 GAGTGGGTAGGGTGGAGGGAGGG - Intronic
1145961126 17:28887037-28887059 TAGTGGGGAGGGAAGAAGGGAGG + Intronic
1146550627 17:33777496-33777518 TGGTGGGCTGGGAGGGAGGTGGG - Intronic
1146634045 17:34491070-34491092 GAATGGGAAGGGAGGAAGGAGGG + Intergenic
1146648609 17:34592198-34592220 AAGTGGGGAGGGAGGAAGGGTGG - Intronic
1146725546 17:35152854-35152876 GAGTGGGGAAGGAGGCAGGTGGG - Intronic
1147165023 17:38588524-38588546 GGGTGGGAAGGGAGGAAGGCCGG + Intronic
1147239920 17:39083920-39083942 TAGTGAGAAGGAAGGAAGCTAGG - Intronic
1147273145 17:39291347-39291369 TGGTAGGTAGGGAGGGAGGGAGG + Intronic
1147360075 17:39924826-39924848 AAGTGGGGAGGGAGGAAGGGAGG + Intronic
1147686747 17:42290474-42290496 GAGTGGGTATGGAGGAAGAGAGG + Intronic
1148008351 17:44453477-44453499 TTGTAGGTAGGTAGGTAGGTAGG + Intronic
1148393674 17:47291555-47291577 TGGTGGGAGGGGAGGAAGGAGGG + Intronic
1148450893 17:47777303-47777325 TAGTGGGATGGGAGTGAGGTGGG + Intergenic
1148560756 17:48604521-48604543 GAATGGGTGGGGAGGAAGGAAGG + Exonic
1149027901 17:52051086-52051108 GAGTGGGAAGGGAGGAAGGAAGG + Intronic
1149290506 17:55213741-55213763 AAATGGGTAGGGACGAGGGTGGG - Intergenic
1149541469 17:57471110-57471132 TAGGGGGTAGGGTGTGAGGTGGG - Intronic
1149868450 17:60163139-60163161 TAGGGGTGGGGGAGGAAGGTGGG + Intronic
1150219713 17:63489207-63489229 TAGAGGGTAGGGAGCAGGCTGGG + Intronic
1150703220 17:67465880-67465902 TAGAGGGCTGGGAGGATGGTAGG + Intronic
1151512709 17:74571059-74571081 CAGTGGGGAGGGAAGAAAGTGGG - Intergenic
1151713123 17:75817946-75817968 TAGGGGGTGGGGAGGAAGAAGGG + Intronic
1152026781 17:77815102-77815124 AAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152811426 17:82384526-82384548 TATTGGGAAGGCGGGAAGGTGGG - Intergenic
1153590887 18:6673272-6673294 TGGTGGCCAGGGAGGAAGATGGG + Intergenic
1153841343 18:9010877-9010899 TGGTGGGGAGGGAGGGAGGGGGG + Intergenic
1155162329 18:23206138-23206160 CGGTGGGCAGGGAGGAAGGCAGG - Intronic
1155243952 18:23889663-23889685 GAGGGGGGAGGGAGGAAGGAAGG + Intronic
1155666524 18:28315959-28315981 TAGGGAGTAGGGAGTTAGGTTGG + Intergenic
1156193897 18:34751342-34751364 GACTGGGTAGGTAGGAGGGTAGG - Intronic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156850984 18:41725958-41725980 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1157323189 18:46649635-46649657 TAGAGGGCAGAGAGGAAGCTGGG - Intronic
1157472085 18:47997359-47997381 TGGTGGCTAGGGAGGGAGGCAGG + Intergenic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158315972 18:56211443-56211465 GTGTGTGTAGGGAGGAAGGAAGG - Intergenic
1158517992 18:58146693-58146715 CAGTGGCTAGGGAGGCAGGCAGG + Intronic
1158558732 18:58496260-58496282 TAGTGGGGAGGAAGGAACGAGGG - Intronic
1160586157 18:79914721-79914743 CAGTGCCAAGGGAGGAAGGTGGG + Intronic
1161218079 19:3104692-3104714 TAGGGGCTAGGGATGCAGGTGGG + Intronic
1162322875 19:9980078-9980100 GAGTGGGCAGGGAGGCAGGGGGG - Intronic
1163034105 19:14561641-14561663 AAGTGGGTGGGGAGGAAGGTTGG + Intronic
1163382606 19:16978835-16978857 TAGAGGGAAGGGTGGATGGTGGG - Intronic
1163492169 19:17623411-17623433 TAGGCGGGAGGGAGGATGGTGGG + Intronic
1163608175 19:18287147-18287169 TAGAAGGTGGGGAGGCAGGTGGG + Intergenic
1163730194 19:18944552-18944574 TGGGGGGGAGGGAGGAAGGAAGG + Intergenic
1164025353 19:21346646-21346668 AAGGGGGTAGGGAGGGAGGGAGG + Intergenic
1164207774 19:23072167-23072189 TAGTAGGAAGGAAGGAAGGCAGG + Intergenic
1165738718 19:38193368-38193390 GAGGGGGGAGGGAGGAAGGGAGG + Intronic
1166011095 19:39943433-39943455 CGGTGGGTATGGAGGAGGGTAGG + Intergenic
1166182225 19:41117004-41117026 TTGTGGATAGGGATGAAGGTGGG - Intronic
1166602114 19:44105663-44105685 AAATGGGGAGGGTGGAAGGTAGG - Intronic
1166631814 19:44413296-44413318 TAGGAGGAAGGGAGGAAGGAAGG - Intergenic
1166667216 19:44688080-44688102 TGTTGGGTTGGGAGGAAGGGCGG + Intergenic
1166681603 19:44771050-44771072 AAGTGGGGAGGGAAGAAGGGAGG - Intergenic
1168402822 19:56095747-56095769 TAGTGGGGAGAGAGGCTGGTGGG - Intronic
924979345 2:206990-207012 GGGGGGGAAGGGAGGAAGGTAGG + Intergenic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
926408684 2:12579805-12579827 TAATGGCTAGGAAGCAAGGTGGG - Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
927254423 2:21027656-21027678 TAGCGGGGAGAGAGGAAGGCGGG + Intronic
927268412 2:21179618-21179640 AAGTTGGTAGTGAGGAAGGAAGG - Intergenic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
928785875 2:34885487-34885509 TAGAGGGAATGGAGGAAAGTGGG - Intergenic
929625764 2:43405065-43405087 TAGAGGGGAAGGAGGAGGGTAGG - Intronic
930900136 2:56496310-56496332 GAGTGGGAAGGGTGGAAGGAGGG + Intergenic
930944382 2:57055165-57055187 TGGAGGGCTGGGAGGAAGGTGGG - Intergenic
931128411 2:59303314-59303336 TATGGGGTGGGGAGGAAGGGAGG + Intergenic
931382873 2:61769691-61769713 TAGTGGGTAGGGAAGGATTTGGG + Intergenic
931610940 2:64099958-64099980 TATTGTCTAGAGAGGAAGGTGGG + Intronic
931682987 2:64768228-64768250 TCGCGGGCAGGGAGGAGGGTAGG - Intergenic
931784752 2:65608822-65608844 GAGTGGGTAGGAAGGCAGGAGGG + Intergenic
932137737 2:69245395-69245417 GAGGGGGAAGGGTGGAAGGTGGG - Exonic
932453708 2:71832508-71832530 TGGAGAGAAGGGAGGAAGGTGGG - Intergenic
932794496 2:74682706-74682728 TTTGGGGGAGGGAGGAAGGTGGG + Intronic
932910391 2:75800206-75800228 TGGTGGGTGGGGAGGAACGTTGG + Intergenic
933252002 2:80039174-80039196 TGGAGGGTAGGGAGGATGGAAGG + Intronic
933286437 2:80389410-80389432 TAGTGAGGAGGGAGGAAGGAAGG - Intronic
935022771 2:99247584-99247606 AAGGAGGGAGGGAGGAAGGTAGG - Intronic
935573763 2:104688447-104688469 TACTGAGTATGGAGGCAGGTAGG - Intergenic
935821775 2:106900439-106900461 TAGTGGGGAGCAAGAAAGGTGGG - Intergenic
936464575 2:112735628-112735650 GAGTGGGAAGGAAAGAAGGTGGG - Intronic
936540160 2:113343118-113343140 TAGTAGGCAGGCAGGAAGGAAGG + Intergenic
937146364 2:119648554-119648576 TAGCGGGTAGGGAGGAACTCTGG - Intronic
937689096 2:124734203-124734225 TGGTGGGATGGGAGGAAGGCTGG + Intronic
938143279 2:128813246-128813268 TAGTGAGGAGGGAGGAGGGGAGG - Intergenic
938547343 2:132346898-132346920 TGGTAGGTAGGTAGGAAGGTAGG + Intergenic
938671177 2:133588345-133588367 AAGAGGGAAGGGAGGAAGGAAGG - Intergenic
938887327 2:135664583-135664605 TGGTGGATAGGGAGGAGGATGGG + Intronic
938925640 2:136039061-136039083 TAGTGGGTAGAGACCAAGGATGG - Intergenic
939434184 2:142152860-142152882 GAGTGGGAAGGAAGGAAGGAAGG - Intergenic
940234581 2:151496002-151496024 TAGTGGATAGAGAGTAAGTTTGG + Intronic
941173897 2:162173490-162173512 TTGGGGGTGGGGAGGAAGATTGG + Intronic
941692389 2:168514480-168514502 TAGTGTGTGGTGGGGAAGGTGGG - Intronic
941937627 2:170998093-170998115 TAGGTGGTAGGTAGGTAGGTAGG - Intronic
942630952 2:177947995-177948017 TAGATGGTAGGCAGGTAGGTAGG + Intronic
942828553 2:180210517-180210539 TAGTGGGAAGAGAGAAAAGTAGG + Intergenic
943167204 2:184344901-184344923 TAGTAGGTTGGTAGGAGGGTGGG + Intergenic
943747789 2:191480164-191480186 CCCTGGGTAGGGAAGAAGGTAGG + Intergenic
944386220 2:199167920-199167942 TAGTGGGGAGGGGCAAAGGTGGG + Intergenic
944492201 2:200268993-200269015 GAGTGGTTAGGAGGGAAGGTAGG + Intergenic
944666975 2:201966988-201967010 TTGGGGGTGGGGAGGGAGGTTGG - Intergenic
945775799 2:214104494-214104516 TAGTGGCAAGGGATGAAGCTGGG + Intronic
945783931 2:214210120-214210142 TAGAGGGTAAGGAAGAAGTTGGG + Intronic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946138514 2:217667991-217668013 AAGTGGGAAAAGAGGAAGGTGGG + Intronic
946214309 2:218172074-218172096 AAGAGGGAAGGGAGGAAGGGAGG + Intergenic
946827755 2:223696115-223696137 GAGTGGATAATGAGGAAGGTGGG - Intergenic
947375454 2:229490570-229490592 TGGGGGGTGGGGAGGATGGTAGG + Intronic
947390161 2:229630782-229630804 GAGTGGGGAGGCAGGAAGGGGGG - Intronic
947505596 2:230706127-230706149 GTGTGGGTAGGGTGGAAGGATGG + Intergenic
947704192 2:232261208-232261230 TGGTGGGGAGGAAGGAAGGAAGG - Intronic
948303002 2:236922378-236922400 CAGTGGATGGAGAGGAAGGTTGG + Intergenic
948479629 2:238241267-238241289 TAGTGGGGACTGAGGAAGGCAGG - Intergenic
1168830245 20:841643-841665 TAGTGGGGAGGGGGCCAGGTGGG + Intronic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1169024452 20:2357231-2357253 TACTGGGAAGGGAGGAATGTCGG - Intergenic
1169781188 20:9312339-9312361 GTGTGTGTAGGGTGGAAGGTGGG - Intronic
1170501867 20:16982613-16982635 AAGTGGGGAGGGAGGAAGAAGGG - Intergenic
1170678816 20:18507055-18507077 GAGTGGGGAGGGAGGCAGGGAGG + Intergenic
1170830037 20:19832315-19832337 GAGTGGGGAGGAAGGAAGGTTGG - Intergenic
1171316468 20:24200003-24200025 TAGAGGGATGGGAGGAGGGTAGG + Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171862402 20:30412933-30412955 AAGTAGGGAGGGAGGGAGGTAGG + Intergenic
1171876214 20:30579652-30579674 TGGTAGGTAGGTAGGAAGGTAGG + Intergenic
1172113581 20:32561250-32561272 TTGCGGGTGGGGAGGTAGGTGGG + Intronic
1172448605 20:35006210-35006232 TTGTGGGTAGGGAGTGAGGGTGG - Intronic
1172479229 20:35261123-35261145 CAGGGGGTAGGGAGTCAGGTAGG - Intronic
1173183811 20:40824014-40824036 GAGAGGGAAGGGAGGAAGATTGG - Intergenic
1173367558 20:42400926-42400948 TACTGGGAAGGAAGGAAGGAAGG + Intronic
1173379057 20:42521116-42521138 GAGTAGGTAGGTAGGTAGGTAGG - Intronic
1173824170 20:46036812-46036834 TTGTGGGGAGGGAGGATGGCTGG + Intronic
1174395548 20:50244668-50244690 TGGGAGGTAGGCAGGAAGGTAGG - Intergenic
1174541946 20:51296638-51296660 AAGTGGTGAGGGAGGAAGCTGGG + Intergenic
1174757424 20:53173730-53173752 GGGTGGGTAGGCAGGTAGGTAGG + Intronic
1174848194 20:53964584-53964606 TATAGGATAGGGATGAAGGTAGG - Intronic
1175491682 20:59384384-59384406 AGGTGAGTGGGGAGGAAGGTGGG + Intergenic
1175528250 20:59651827-59651849 TGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175558241 20:59890580-59890602 AAGTAGGTAGGTAGGTAGGTAGG + Intronic
1175607953 20:60327133-60327155 TGGTGGGCAGGCAGGTAGGTGGG + Intergenic
1175780253 20:61677643-61677665 AAGTGGGTAGGTAGGTGGGTGGG + Intronic
1175889372 20:62309595-62309617 TAGGGGGGTGGGAGGAGGGTGGG + Intronic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1176651222 21:9549396-9549418 TAGTAGGTAGGAAGGAAGGAAGG + Intergenic
1177097376 21:16853159-16853181 AAGTAGGGAGGGAGGAAGGAAGG + Intergenic
1177649248 21:23939443-23939465 TGGTGGGGTGGGAGGAAGGAGGG - Intergenic
1177746797 21:25224998-25225020 AGGTGGGTAGGGGGGAAGCTGGG - Intergenic
1178058036 21:28821160-28821182 TGGTGGGTGGAGTGGAAGGTTGG - Intergenic
1178346634 21:31834140-31834162 TAGTTGGGAGGCAGGAAGGCAGG + Intergenic
1178383647 21:32132337-32132359 GAGTGGGGAGGGATGAGGGTTGG + Intergenic
1178516080 21:33248375-33248397 TAGGGGGGAGGGAGGGAGGGGGG + Intronic
1178576741 21:33799456-33799478 CACTGGGTAGGGAGGAGGGCGGG + Intronic
1178631664 21:34266406-34266428 TGATGGGCAGGGAGGGAGGTGGG - Intergenic
1178870068 21:36366179-36366201 CAGTGGGGAGAGAGGAAGGGAGG - Intronic
1178934742 21:36851529-36851551 TGGGGGGCAGGGAGGTAGGTGGG + Intronic
1180028239 21:45181159-45181181 TAGAGGTCAGGGAGGAAGCTGGG + Intronic
1180186638 21:46143323-46143345 GAGTGGGGAGAGAGGGAGGTGGG - Intronic
1181806175 22:25375739-25375761 TGGTGGGTGGGGTGGGAGGTGGG - Intronic
1181997912 22:26897630-26897652 GAGTGGGAAGGGAGGCTGGTGGG + Intergenic
1182076946 22:27501387-27501409 TTGGGGGTAGGGAGGTGGGTGGG - Intergenic
1182332315 22:29559992-29560014 GAGTGAGTAGGGAAGAATGTGGG - Intronic
1183251239 22:36731901-36731923 TGTTGGGAAGGGATGAAGGTGGG - Intergenic
1183698782 22:39438126-39438148 AAGGGGGAAGGGAGGAAGGGAGG - Intergenic
1183718725 22:39549790-39549812 TGGTGGGTGGGGAGTAAGGATGG - Intergenic
1184642398 22:45879495-45879517 AAGTGTGTAGGGAGGAGGGAGGG - Intergenic
1184690568 22:46115490-46115512 TGGAGGGTAGGGAGGGAAGTGGG - Intergenic
1184783517 22:46660767-46660789 GAGTGGGGAGGGAGGAAGCTGGG - Intronic
1184820171 22:46904154-46904176 TGGTAGGTAGGTAGGTAGGTAGG - Intronic
1184938031 22:47739395-47739417 TAGTGAGTGGGGTGGGAGGTGGG + Intergenic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
1184993854 22:48188320-48188342 GAGTGGGTGGGGTGGAAGCTTGG + Intergenic
950015869 3:9754575-9754597 TAGAGGGTGGGGAGGTAGGAGGG + Intronic
950167854 3:10815186-10815208 TTGTGGCTAGAGAGGAAGGGAGG - Intergenic
950588445 3:13915331-13915353 TTGGGGGAAGGGTGGAAGGTGGG + Intergenic
951526830 3:23661364-23661386 TAGTGAGTGGGTAGGAGGGTTGG + Intergenic
951652922 3:24972138-24972160 GAAAGCGTAGGGAGGAAGGTAGG - Intergenic
951793459 3:26512415-26512437 TAGGGGGGAGGGGGGAAGGCTGG - Intergenic
951958446 3:28285610-28285632 TATTGTGTAGGGAGGAAGTCTGG - Intronic
952046395 3:29326577-29326599 CAGAAGGTAGTGAGGAAGGTAGG - Intronic
952327749 3:32336218-32336240 TAGGCACTAGGGAGGAAGGTGGG - Intronic
952455514 3:33468026-33468048 TACTTGGTAGGGGGGAAGGGTGG + Intergenic
952913093 3:38207886-38207908 GAGGGGGGAGGGAGGAAGGACGG - Intronic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
953502541 3:43451602-43451624 TGGTGGTTAGGGATGAAGGGTGG + Intronic
953703074 3:45211466-45211488 TAGTGGGGAGGGGGGATGGCTGG + Intergenic
954349476 3:50030919-50030941 TAGGGGGCTGGGGGGAAGGTGGG + Intronic
954538931 3:51381254-51381276 TAGTGGACAGGGAGGTAGGGTGG - Exonic
954915121 3:54142277-54142299 TAGTGGCAAGGGAGGGAGTTTGG - Intronic
955025817 3:55166269-55166291 TAATGGTTGGGGAGGAAGGGAGG + Intergenic
955081223 3:55659481-55659503 TAGGGGGTAGAAAGGAAGGGTGG - Intronic
955213233 3:56961686-56961708 TGGTGGGATGAGAGGAAGGTGGG - Intronic
955478868 3:59368786-59368808 AAGTGGCTAGTGAGCAAGGTAGG - Intergenic
955933027 3:64077023-64077045 AAGTGGGAAAGGAGGAAGGTGGG + Intergenic
955942263 3:64157751-64157773 GAGTGGCTGGGGAGGGAGGTGGG + Intronic
956462030 3:69482210-69482232 TAAGGGGTAGGGAGTAGGGTGGG + Intronic
957297448 3:78351211-78351233 AAGTGGGGAGGAAGGAAGGAAGG - Intergenic
957830845 3:85516441-85516463 AAGTTGGTAGGCAGGTAGGTAGG + Intronic
957893207 3:86386685-86386707 GTGGGGGTCGGGAGGAAGGTCGG + Intergenic
958967065 3:100570816-100570838 TTGGGGGTAGAGGGGAAGGTTGG - Intronic
958974946 3:100657236-100657258 ATGTGTGTAGGGTGGAAGGTGGG - Intronic
960311188 3:116118298-116118320 TAGGGGGAAGGAAGGAAGGTTGG - Intronic
960525435 3:118704826-118704848 GAGGGGGGAGGGAGGAAGGAAGG - Intergenic
960554868 3:119016755-119016777 GACTGGGGAGGGAGGAGGGTGGG - Intronic
961340088 3:126212140-126212162 GAGGGGGAAGGGAGGAAGGGAGG + Intergenic
961603777 3:128078875-128078897 TTCTGGATAGGTAGGAAGGTGGG - Intronic
962526425 3:136241794-136241816 TAGTGGGCGGGAGGGAAGGTAGG + Intergenic
962527000 3:136246040-136246062 GAGAGGGAAGGAAGGAAGGTGGG - Intergenic
963087065 3:141447176-141447198 TAATGGGTGGGGTGGAGGGTGGG - Exonic
963945270 3:151138996-151139018 TAGTAGGTAGGTAGGCAGGTAGG - Intronic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
964758254 3:160108535-160108557 TATTGGGTTGGGAGGAAGACAGG + Intergenic
965291354 3:166885870-166885892 CAATGGGTAGGGTGGAATGTGGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965607101 3:170508460-170508482 CACTGGGTAGGCAGGAAGGTTGG + Intronic
965709376 3:171541923-171541945 AAGGAGGAAGGGAGGAAGGTAGG - Intergenic
965823683 3:172709857-172709879 TTGTGGGGAGGGAGGAGGCTTGG + Intronic
966332629 3:178831748-178831770 GAGTGTGGAGGGAGGAAGGAGGG + Intronic
966431081 3:179832347-179832369 TGGTGGGTAGGTAGGCAGGTGGG - Intronic
966431096 3:179832411-179832433 TAGTGGGTAGGCAGGTGGGTGGG - Intronic
966431106 3:179832451-179832473 AGGTGGGTAGGTAGGTAGGTGGG - Intronic
966431109 3:179832459-179832481 TGGTGGGTAGGTGGGTAGGTAGG - Intronic
966431146 3:179832599-179832621 TGGTGGGTAGGTGGGTAGGTAGG - Intronic
966431203 3:179832836-179832858 TGGTGGGTAGGTAGGTAGGTGGG - Intronic
966473101 3:180314398-180314420 AAGTGGGAAGAGAGGAAGGTGGG - Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966630013 3:182062027-182062049 TGGTGGGTAGGGATGGAGTTGGG + Intergenic
967350763 3:188511300-188511322 GAGAGGGGAGGGAGGAAGGCAGG - Intronic
967673711 3:192270782-192270804 AAGTGGGAAGGAAGGAAGGAAGG + Intronic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968695044 4:2020248-2020270 AAGAGGGTAGGAAGGAAGGAAGG - Intronic
969500972 4:7552742-7552764 GAGTGGAGAGGCAGGAAGGTGGG - Intronic
969682941 4:8653210-8653232 AAGTGGGTAGGAAGGAGGGAGGG - Intergenic
971146922 4:23987574-23987596 TGGTGGGTAGGGTGGGAGTTAGG - Intergenic
972103200 4:35447707-35447729 TAGAGGGTAAGAAGGAAGGAAGG + Intergenic
972459717 4:39289980-39290002 AAGTGAGTATGGAGTAAGGTGGG + Exonic
973698256 4:53512462-53512484 CACTGGGTAGGGAGGAAGACTGG - Intronic
973925684 4:55735206-55735228 GAGTGGGGAGGGAGGAAGGGGGG + Intergenic
975536931 4:75460735-75460757 AAGTGGGGAGGAAGGAAGGGAGG + Intergenic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
976070828 4:81237603-81237625 TGGAGGGTAGTGAGGCAGGTGGG - Intergenic
976934918 4:90618674-90618696 TAAAGGGAAGGGAAGAAGGTAGG + Intronic
976971608 4:91109336-91109358 TGGTGGGTAGGTAGAAAGGTAGG - Intronic
977293927 4:95191782-95191804 AGGTGAGAAGGGAGGAAGGTGGG - Intronic
977895293 4:102357700-102357722 GAGTGAGCAGGGAGGAAGGGGGG + Intronic
977969211 4:103193103-103193125 AAGTGGGTAGGCTGGAGGGTTGG + Intronic
977990995 4:103442363-103442385 TGGTGGGAAGGAAGGAAGGGAGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978554798 4:109968711-109968733 TATTAGGTAGGTAGGTAGGTAGG - Intronic
978607198 4:110493696-110493718 AAGTGGGTAGGGAGCCAGGAGGG - Intronic
979809921 4:125024542-125024564 TAGTGGCAAAGTAGGAAGGTGGG - Intergenic
979865066 4:125744137-125744159 AAGTGGGGAGGGAGGAAGGAAGG + Intergenic
980115964 4:128679186-128679208 CAGTGGGCATGGTGGAAGGTGGG + Intergenic
980325837 4:131344765-131344787 TAGAAGGTAGAAAGGAAGGTTGG - Intergenic
980711769 4:136578364-136578386 AAGTGGGGAGAGGGGAAGGTTGG + Intergenic
980734676 4:136869415-136869437 AGGTGGGAAGGGAGGAAGGGAGG + Intergenic
981031129 4:140126914-140126936 TAGTGGGTAGAGATGGAGATAGG - Intronic
981287291 4:143033234-143033256 TAGTGGATGGGGAGGGAAGTGGG + Intergenic
981912272 4:149995452-149995474 GAGGGGGAAGGGAGGAAGGGAGG + Intergenic
982170435 4:152656228-152656250 TAGTGGTTAGCCAGGCAGGTAGG - Intronic
982233844 4:153233666-153233688 GAGGTGGTAGGGAGGCAGGTGGG + Intronic
982445803 4:155489498-155489520 TAGTAGGAAGGGAAGAAAGTGGG + Intergenic
982509816 4:156267466-156267488 TAGTTGGTAGGGATGAGTGTGGG - Intergenic
983404195 4:167304671-167304693 AAGTAGGTAGGTAGGTAGGTAGG + Intergenic
983500986 4:168499354-168499376 GAGGGGGGAGGGAGGAAGGGAGG + Intronic
983503150 4:168523275-168523297 GAGGGGGGAGGGAGGAAGGAGGG + Intronic
984482716 4:180326553-180326575 TAGGGGTTAGGGATGGAGGTGGG - Intergenic
984814669 4:183825336-183825358 CAGTAGGTTGGGAGGAAGGTGGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985864043 5:2497858-2497880 AAGTGGGGAGGGGGGCAGGTGGG + Intergenic
986007375 5:3679281-3679303 GAGTGGGAAGGAAGGAAGGAGGG - Intergenic
986495076 5:8333213-8333235 GAGTGGGTAGGGAGGGAGTGAGG + Intergenic
986740176 5:10699179-10699201 AAGTAGGTAGGTAGGTAGGTAGG - Intronic
987162420 5:15157829-15157851 AAGTGGGGAAGGAGGAAGATTGG + Intergenic
987454733 5:18129556-18129578 TAGTGGTGAGGGAGGAAGAAGGG - Intergenic
987962989 5:24834473-24834495 TGGTTGGTAGGTAGGTAGGTAGG - Intergenic
988394999 5:30685678-30685700 TAGTGGATTGGGGAGAAGGTTGG + Intergenic
988786572 5:34570727-34570749 CAGTGGGAAGAGAGGAAGGGCGG + Intergenic
989665096 5:43844959-43844981 TAATAGGAAGAGAGGAAGGTTGG - Intergenic
990088613 5:52011556-52011578 TTGTGGGTCTGGATGAAGGTTGG - Exonic
990604727 5:57396905-57396927 TAGTGGGTAGGGAGGATGTGTGG + Intergenic
991480343 5:67071359-67071381 TATTTGGTAGGGAGGGAGGGAGG + Intronic
992519755 5:77538446-77538468 TAGTGGGGAGGGAAGAAGAGAGG - Intronic
992601905 5:78409760-78409782 TAGTAGATAAGGATGAAGGTAGG - Intronic
993099853 5:83524511-83524533 AGGTAGGTAGGTAGGAAGGTAGG - Intronic
993385042 5:87252549-87252571 GAGCGGGGAGGGCGGAAGGTGGG + Intergenic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
994047450 5:95325912-95325934 AAGGGGGTAGGGTGGAAGGGAGG - Intergenic
995289005 5:110428119-110428141 TAGGGGGTTGGGGGAAAGGTAGG - Intronic
995982205 5:118117955-118117977 AAGTGGGGAGGGAGGGAGGCAGG - Intergenic
996201992 5:120686558-120686580 TAGTGGGAAAGGAGGGAGATGGG - Exonic
997033574 5:130160330-130160352 TAGTGGGCAAGGAGGAAAGCAGG - Intronic
998167703 5:139853781-139853803 TGGGGGGTTGGGAGGGAGGTGGG + Intronic
998511682 5:142719012-142719034 TGGTGGGGAGGGAGGATGGATGG + Intergenic
998892102 5:146757172-146757194 GAGTGGAGAGGGAGGGAGGTAGG + Intronic
999375830 5:151085905-151085927 GAGAGGACAGGGAGGAAGGTGGG - Intronic
999869295 5:155732460-155732482 GAGTGGGGAGGGAGAAAGCTTGG - Intergenic
999924347 5:156358890-156358912 TGGTGGGTGGGGAGACAGGTGGG + Intronic
1000200430 5:159004532-159004554 TAGTAGGTAGGTAGGTAGGTAGG + Intronic
1000593385 5:163185556-163185578 TAGCGGGTCAGGAGGAAGGAAGG + Intergenic
1000856449 5:166404027-166404049 GAGGGGGGAGGGAGGAAGGAAGG - Intergenic
1001080461 5:168663613-168663635 AATGGGGTAGGTAGGAAGGTAGG - Intronic
1001409315 5:171499152-171499174 AAGTGGGTAGGGAAGATGCTTGG + Intergenic
1001686734 5:173598997-173599019 TTGTGGGGAGGCAGGAAGCTGGG + Intergenic
1001766832 5:174255703-174255725 TATTAGGAAGGGAGGAGGGTGGG + Intergenic
1001793483 5:174481940-174481962 GAGAGGGAAGGGAGGAAGGGAGG + Intergenic
1001932273 5:175681677-175681699 TAGTGCAAAGGGAGGAAGGGAGG + Intronic
1002466604 5:179411880-179411902 TGGTGGGGAGGGTGGAAGGTCGG - Intergenic
1002466676 5:179412043-179412065 TAGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466756 5:179412229-179412251 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466767 5:179412252-179412274 TGGAGGGGAGGGTGGAAGGTCGG - Intergenic
1002466776 5:179412275-179412297 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466787 5:179412298-179412320 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466806 5:179412343-179412365 TTGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466845 5:179412434-179412456 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466856 5:179412457-179412479 GGGGGGGGAGGGAGGAAGGTCGG - Intergenic
1002466906 5:179412572-179412594 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466917 5:179412595-179412617 TGGAGGGGAGGGTGGAAGGTCGG - Intergenic
1002467026 5:179412849-179412871 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002467037 5:179412872-179412894 TTGGGGGGAGGGTGGAAGGTCGG - Intergenic
1003521503 6:6862390-6862412 GAGAGGGAAGGGAGGAAGGTTGG + Intergenic
1004086577 6:12455171-12455193 AAATGGGTAGGTAGGTAGGTAGG + Intergenic
1004485335 6:16061009-16061031 ATGTAGGTAGGGAGGAATGTAGG + Intergenic
1005480788 6:26253430-26253452 TAGTGGACAGGGAGGAGGGGTGG + Intergenic
1005582189 6:27245974-27245996 GAGTGGGGAGGGAGGAAGGCAGG - Intergenic
1005631058 6:27708423-27708445 AAGTAGGGAGGGAGGGAGGTAGG - Intergenic
1006027101 6:31154165-31154187 TGGAGGGCAGTGAGGAAGGTGGG - Intronic
1006160318 6:32037176-32037198 TTGTGGGTAAGGAGGCAGTTTGG - Intergenic
1006627812 6:35410027-35410049 GAGTGGGTAGACAGGCAGGTGGG + Intronic
1006668753 6:35716673-35716695 AGTTGGGTAGGGAGGAAGCTTGG - Intronic
1007102098 6:39256286-39256308 TACTGGGAAAGGAGGAAGGCTGG - Intergenic
1007210966 6:40193139-40193161 TAGGAGGGAGGGAGGAAGGAAGG - Intergenic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1007741060 6:44009679-44009701 AAGTGGGGAGGTAGGAAGGGAGG + Intergenic
1007809837 6:44477951-44477973 TAGAGAGTAGGGTGCAAGGTGGG + Intergenic
1008418672 6:51271934-51271956 AAGGGGGAAGGGAGGAAGGGAGG + Intergenic
1008526129 6:52408847-52408869 TAGAGGGTAGTGAGAAGGGTCGG - Intergenic
1008548462 6:52604624-52604646 TAGTTGGTAAGGAGGAGGATAGG + Intergenic
1010015648 6:71103015-71103037 TAATGAGCAGGGAGGAAGGATGG - Intergenic
1010259777 6:73802345-73802367 TGGTGGGTAGGCAGGCAAGTTGG + Intronic
1011411135 6:87067787-87067809 TAATGGGTCGGGAGTAAGGTAGG - Intergenic
1013118048 6:107116893-107116915 TAGGGCGGAGGGAGGAAGGGAGG + Intergenic
1015121763 6:129708168-129708190 TTGAGGGCAGGGAGGAAGGAGGG - Intronic
1015549515 6:134397558-134397580 AAGTAGGTAGGTAGGTAGGTAGG - Intergenic
1015911463 6:138171529-138171551 TAGTGGGAGGGGAAGAAGGTGGG - Intronic
1016387688 6:143544248-143544270 GAGTGGGAAGGAAGGAAGGCGGG + Intronic
1016526676 6:145009681-145009703 AGTTGGGTAGGGAGGAAGGGAGG + Intergenic
1017698167 6:157039756-157039778 AGGTAGGTAGGTAGGAAGGTAGG - Intronic
1017974518 6:159344689-159344711 GAGTGGGGAGGAAGGAAGATGGG + Intergenic
1018621689 6:165735110-165735132 TGGTAGGTAGGTAGGTAGGTTGG + Intronic
1018621734 6:165735364-165735386 GGGTGGGTAGGTAGGTAGGTAGG + Intronic
1019059082 6:169242794-169242816 TGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059094 6:169242827-169242849 CAGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059105 6:169242860-169242882 TGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059133 6:169242943-169242965 CAGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059164 6:169243041-169243063 TGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059173 6:169243066-169243088 CAGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059181 6:169243091-169243113 TGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019436047 7:1022750-1022772 AACTGGGGAGGGAGGACGGTTGG - Intronic
1019919990 7:4157355-4157377 AAGTGGGAAGGGAGGAAGAAGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020865114 7:13550366-13550388 AGGTGGGTAGGGAAGAAGGTGGG + Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021491802 7:21227145-21227167 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1023736078 7:43237139-43237161 AAGTAGGTAGGTAGGTAGGTAGG + Intronic
1023739249 7:43263712-43263734 AAGAAGGGAGGGAGGAAGGTGGG + Intronic
1023955506 7:44884303-44884325 TAGTGGAGAGGGAGCAAGGGAGG - Exonic
1024380954 7:48695321-48695343 AAGAGGGGAGGGAGGAAGGAAGG + Intergenic
1024608282 7:51040695-51040717 TGGTGGGGAGGGAGGGAGTTCGG - Intronic
1024695020 7:51847054-51847076 TACTGGGAAGGGGTGAAGGTAGG - Intergenic
1025277902 7:57600303-57600325 TAGTAGGTAGGAAGGAAGGAAGG + Intergenic
1025307757 7:57879386-57879408 GAGTGGGAAGGAAGGAAGGAAGG - Intergenic
1026882701 7:73917663-73917685 TGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1027229692 7:76265050-76265072 TTGTGGGGTGGGAGGAAGGAGGG - Intronic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027971262 7:85084753-85084775 GAGTGTGGAGGGTGGAAGGTGGG - Intronic
1028449666 7:90967104-90967126 AAGGAGGGAGGGAGGAAGGTGGG + Intronic
1028480125 7:91295121-91295143 GAGAGGGTGGGGAGGGAGGTGGG + Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028715641 7:93964263-93964285 AAGGGGGAAGGGAGGAAGGAAGG - Intronic
1029118653 7:98251994-98252016 TCGCGGGGAGGGAGGAAGGAGGG - Intronic
1030698618 7:112614637-112614659 TAGTGGGGAGGGAGGAATGAGGG - Intergenic
1032324025 7:130909698-130909720 TAGTTGGATGGGAGGCAGGTGGG - Intergenic
1032356807 7:131218778-131218800 TCGGGGGTCGGGGGGAAGGTTGG - Intronic
1032675879 7:134129329-134129351 TAGAGGGGAGGGAGGAAGGGAGG - Intronic
1032704205 7:134408090-134408112 AAGTGGATAAGGAGGTAGGTAGG + Intergenic
1032790963 7:135242120-135242142 AAGTTGGAAGGGAGGAAGGGAGG + Intronic
1032815029 7:135464539-135464561 AAGTGGGGAGGGTGGAAGGAGGG + Intronic
1033071859 7:138210064-138210086 TGGTTGGTAGGGAGAAATGTGGG + Intergenic
1033346363 7:140528170-140528192 TAGGGGGCAGGGAGTAAGGGTGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1034117474 7:148596791-148596813 GAGTGGGGAAGGAGGAAGGGAGG - Intronic
1034362653 7:150514205-150514227 TGTGGGGTAGAGAGGAAGGTGGG + Intergenic
1034491752 7:151396534-151396556 AAGCGGGTGGGGGGGAAGGTAGG + Intronic
1034632851 7:152544141-152544163 AAGTGGGTGGGGAGGATGTTAGG + Intergenic
1034874874 7:154716340-154716362 AAGTGGGTAGGGATGCAGGGTGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035776352 8:2191408-2191430 GAGGGGGAAGGGAGGAAGGGAGG - Intergenic
1035899905 8:3448298-3448320 TGGTGGGAAGGAAGGAAGGAAGG + Intronic
1036213757 8:6863134-6863156 GAGCGGGTAGGGAGGCTGGTGGG + Intergenic
1036542751 8:9734799-9734821 AAGTAGGTAGGTAGGTAGGTAGG - Intronic
1036542752 8:9734803-9734825 TAGTAAGTAGGTAGGTAGGTAGG - Intronic
1036584054 8:10106812-10106834 GAGTGGGTAGGTAGGTGGGTGGG - Intronic
1036719945 8:11164914-11164936 AAGTGGGAAGGTAGGCAGGTGGG - Intronic
1037115859 8:15226182-15226204 AAGTAAGTAGGGAGGTAGGTAGG - Intronic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037567237 8:20128084-20128106 GAGAGGGGAGGGAGGAAGGGAGG + Intergenic
1037951314 8:23020015-23020037 CAGAGGGGAGGGAGGAAGGAAGG + Intronic
1038240556 8:25804229-25804251 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1038366678 8:26942875-26942897 AAGTAGGTAGGTAGGTAGGTAGG + Intergenic
1038539119 8:28376647-28376669 TAGTGGGTTTGGGGGAAAGTTGG - Intronic
1039470912 8:37813548-37813570 TGATGGGTAGGGGGGTAGGTTGG - Intronic
1039689290 8:39846302-39846324 GAATGGGAAGGGAGGAAGGGAGG + Intergenic
1040629260 8:49190797-49190819 GAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1040898202 8:52390225-52390247 TAACGGGAAGGGAGGAAGGGAGG - Intronic
1041149517 8:54916890-54916912 AACTGGGCAGGGAGGCAGGTAGG + Intergenic
1041161016 8:55044049-55044071 TAGTGGGAAGGGAAGAAGCAGGG - Intergenic
1041538402 8:58954904-58954926 TAGTGGGTGAGGAAGCAGGTGGG + Intronic
1041579282 8:59438810-59438832 GAGTGGGGAGGAAGGAAGGGGGG - Intergenic
1042094539 8:65199014-65199036 AAGGGGGCAGGGAGGAAGGGGGG + Intergenic
1042487984 8:69367513-69367535 TGGTGGGAAGGGAGGAAAGTAGG - Intergenic
1043019361 8:74982286-74982308 TTGGGGGTAAGGAGGAGGGTTGG - Intergenic
1043127839 8:76422209-76422231 TAGTGGGAAGTGAGGATAGTAGG - Intergenic
1043174683 8:77010232-77010254 TAGGGGCTGGGGATGAAGGTAGG - Intergenic
1044357047 8:91234808-91234830 AAGTAGGTAGGTAGGTAGGTAGG - Intronic
1044735663 8:95275645-95275667 TGGTGGGGAGGGAGGTAGGGAGG - Intergenic
1044768508 8:95603849-95603871 GGATGGGGAGGGAGGAAGGTAGG - Intergenic
1044832433 8:96262560-96262582 TGCTGGGTAGGGACGAAGGCTGG - Intronic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045311611 8:101008064-101008086 AAGGAGGTAGGGAGGAAGGATGG + Intergenic
1045412086 8:101929546-101929568 GAGGGGGGAGGGAGGAAGGAAGG + Intronic
1045413710 8:101945321-101945343 TGGTGGGTGGAGATGAAGGTGGG + Intronic
1045460043 8:102417435-102417457 TACTGAGGAGGGAGGAAGCTAGG + Intergenic
1045487115 8:102640395-102640417 AAGAGGGAAGGGAGGAAGGAGGG + Intergenic
1045487178 8:102640608-102640630 AAGAGGGAAGGGAGGAAGGGAGG + Intergenic
1045487190 8:102640640-102640662 AAGAGGGAAGGGAGGAAGGGAGG + Intergenic
1045487205 8:102640680-102640702 AAGAGGGAAGGGAGGAAGGGAGG + Intergenic
1045550100 8:103163840-103163862 TTGTGGGAAGGAAGGAAGGAAGG - Intronic
1045661785 8:104445627-104445649 TAGTGGGGAGGGATGGCGGTGGG + Intronic
1046002357 8:108436187-108436209 AAGTGGGTAGGAAGAAAGATTGG - Intergenic
1046760668 8:118016580-118016602 TGGTGGGAAGAGAGGAAGGCAGG + Intronic
1046848227 8:118942916-118942938 AGGTAGGTAGGTAGGAAGGTAGG - Intronic
1046860707 8:119088157-119088179 TAGTGGGAAGGAAGGAGAGTGGG + Intronic
1047032168 8:120894163-120894185 TTGGGGGCAGGGAGGAAGGAGGG - Intergenic
1047741845 8:127812663-127812685 GGGAGGGAAGGGAGGAAGGTAGG + Intergenic
1047834576 8:128674621-128674643 TTGGGGGCAGGGAGGAAGGGAGG - Intergenic
1048036511 8:130682527-130682549 TAGAGGGTTGGGAGGAAGCCAGG + Intergenic
1048528470 8:135226247-135226269 TGGTGGGTGGGGTAGAAGGTGGG - Intergenic
1049397039 8:142405695-142405717 CAGAGGGTAGAGAGGAAGGGTGG - Intergenic
1049425470 8:142536093-142536115 GAGTGGGTGGGTAGGTAGGTGGG + Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050316620 9:4408390-4408412 GGGGCGGTAGGGAGGAAGGTGGG + Intergenic
1050650161 9:7767293-7767315 TTGTGGGGTGGGAGGAAGGGGGG - Intergenic
1050998455 9:12249345-12249367 TAGATGGTAGGTAGGTAGGTAGG + Intergenic
1051679437 9:19592477-19592499 AGGTGGGTAGGTAGGTAGGTAGG - Intronic
1052316731 9:27123179-27123201 AAGTGGGAAGGGAGGGAGATGGG + Intronic
1052563540 9:30116850-30116872 TAGGGGGTGGGGAGGTAGGAGGG + Intergenic
1052730575 9:32280504-32280526 GAGAAGGTAGGGAGGGAGGTGGG - Intergenic
1052922358 9:33981761-33981783 AGGTAGGTAGGTAGGAAGGTAGG + Intronic
1053550278 9:39070946-39070968 TACTGGGAAGGCAGGAAGGTGGG + Intergenic
1053814388 9:41891059-41891081 TACTGGGAAGGCAGGAAGGTGGG + Intronic
1054616208 9:67296381-67296403 TACTGGGAAGGCAGGAAGGTGGG - Intergenic
1055028525 9:71748313-71748335 AAGTGGGTAGCTGGGAAGGTGGG - Intronic
1055113401 9:72582377-72582399 TGGTGGGCTGGGGGGAAGGTAGG - Intronic
1055530690 9:77179858-77179880 TAGTGAGAAGGGAGGAAATTGGG - Intronic
1055983857 9:82035709-82035731 TAATGGCTAGGGAGAATGGTTGG + Intergenic
1056063201 9:82906455-82906477 TAGTGGAGAGGGAGCAAGGGGGG + Intergenic
1056073547 9:83014862-83014884 TAGTGGGTGGAGGGGAAGGGAGG - Intronic
1056101276 9:83302602-83302624 TATTAGGGAGGGAGGAAGGTGGG - Intronic
1056289557 9:85128996-85129018 AAGTGGGGAGGCAGGTAGGTGGG - Intergenic
1056306595 9:85296676-85296698 TGGTGGGGAGGAAGGAAGGAAGG - Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057544275 9:96005659-96005681 TGGAGGGTAGGGACGCAGGTGGG + Intronic
1057936414 9:99243070-99243092 TTCTGGGTAGGAAGGAGGGTCGG + Intergenic
1058220545 9:102295028-102295050 TGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1058220546 9:102295032-102295054 TGGTTGGTAGGTAGGTAGGTAGG - Intergenic
1058674433 9:107388401-107388423 AAGAGGGTAGAGAAGAAGGTTGG + Intergenic
1059053274 9:110952384-110952406 TAGAGGGTGAGGGGGAAGGTGGG - Intronic
1059340876 9:113597005-113597027 CAGGGGGCAGGGAGGCAGGTGGG - Exonic
1059487991 9:114642190-114642212 TTGAGGGTGGGGAGGAAGGAGGG - Intronic
1059695938 9:116730546-116730568 TTGTGTGGAGGGAGGAAGGGAGG + Intronic
1059977732 9:119736111-119736133 CAGGAGGTAGGAAGGAAGGTAGG + Intergenic
1060379628 9:123155054-123155076 TAGTGGGTAAGTAGAAAGGTCGG + Intronic
1060702671 9:125772000-125772022 CAGTGGGGTGGGAGGTAGGTAGG + Intronic
1060725338 9:126002508-126002530 TGGTGTGTATGGAGGAAGGGTGG + Intergenic
1060892171 9:127195834-127195856 TGGTAGGTAGGTAGGTAGGTAGG - Intronic
1060967689 9:127720916-127720938 AAGGGGGAAGGGAGGAAGGGAGG - Intronic
1061647749 9:132019601-132019623 TTGTGGGTAGGGGGGAAGATTGG - Intronic
1061651606 9:132054870-132054892 TGGAGGGTAGGGAGGAGGGCAGG - Intronic
1061754362 9:132802455-132802477 CAGTGGTTGGGGTGGAAGGTGGG - Intronic
1061974784 9:134062609-134062631 GAGTGGGTAGAGAGGCGGGTAGG - Intronic
1062050614 9:134444678-134444700 AAGTAGGTAGGGAGGAGGGAAGG - Intergenic
1203628957 Un_KI270750v1:52946-52968 TAGTAGGTAGGAAGGAAGGAAGG + Intergenic
1185521103 X:740311-740333 TACGTGGTAGGGAGGAAGATTGG + Intergenic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185737654 X:2505206-2505228 AAGTGGGTTGTGGGGAAGGTAGG - Intergenic
1185742836 X:2547587-2547609 TTGTGGGTAAGGAGCAGGGTAGG - Intergenic
1185933529 X:4230004-4230026 TAGTAGGTAGATAGGTAGGTAGG - Intergenic
1185937731 X:4277808-4277830 GAGAAGGGAGGGAGGAAGGTAGG - Intergenic
1186137303 X:6533571-6533593 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186228911 X:7431323-7431345 TAATAGGTAGGTAGGTAGGTAGG - Intergenic
1186246591 X:7622390-7622412 AAGGAGGTAGGGAGGAAGGAAGG - Intergenic
1186267141 X:7844168-7844190 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186298004 X:8169897-8169919 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324846 X:8466535-8466557 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186600775 X:11034532-11034554 TACTAGGTGGGGAGGAAGGGAGG + Intergenic
1187090186 X:16088231-16088253 CAGTGGATAGAGGGGAAGGTTGG - Intergenic
1187245422 X:17549409-17549431 TAGTGGGGAGGGTGGAGGGTGGG - Intronic
1189701724 X:43719866-43719888 TAGTGGGGAAACAGGAAGGTTGG + Intronic
1190064071 X:47228679-47228701 TGGTGGGTAAGCAGGTAGGTGGG - Intronic
1190248809 X:48707358-48707380 AAGGAGGGAGGGAGGAAGGTAGG - Intronic
1190332812 X:49246602-49246624 TAGTGGGAAGGCTGGAGGGTGGG + Intronic
1190430911 X:50377024-50377046 CAGTGGGTAGAGGGGAAGGAGGG + Intronic
1190805381 X:53831004-53831026 GAAAGGGGAGGGAGGAAGGTAGG - Intergenic
1190844788 X:54182346-54182368 TAGAGGGTAGTTAGGCAGGTAGG + Intronic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1191975674 X:66868678-66868700 TAGGAGGGAGGGAGGAAAGTGGG - Intergenic
1192626615 X:72735159-72735181 AAGGGGGTAGGGAGGAAGTGGGG - Intergenic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1193998233 X:88392920-88392942 TATGGGGTAGGGAAGAATGTTGG + Intergenic
1194320433 X:92440300-92440322 GAGTGGGGAGGGAGGGAGGGAGG - Intronic
1194925856 X:99822132-99822154 TAGGGGGTTGGCGGGAAGGTGGG + Intergenic
1195234915 X:102887808-102887830 AGGTGGGAAGGGAAGAAGGTGGG - Intergenic
1195234920 X:102887824-102887846 GAAAGGGAAGGGAGGAAGGTGGG - Intergenic
1195240923 X:102951054-102951076 GAGAGGGGAGGGAGGAAGGGAGG - Intergenic
1195248272 X:103017067-103017089 GAGTAGGGAGGGATGAAGGTTGG - Intergenic
1195505844 X:105656094-105656116 TGGGGGGTTGGGAGGGAGGTAGG - Intronic
1195980187 X:110568992-110569014 GAGTGGAGAGGGAGGAAGGTAGG + Intergenic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1196767609 X:119262393-119262415 TTGGAGGTAGGGAGGGAGGTAGG + Intergenic
1197226568 X:123961172-123961194 TAGGAGGTAGGGAGGAAGGGGGG - Intronic
1197546649 X:127833288-127833310 TAGAGGCTAGGCAGGGAGGTGGG - Intergenic
1197825655 X:130587736-130587758 TAGTTGGTAGAGAAGAAAGTAGG - Intergenic
1197898095 X:131338846-131338868 AAGTTGGGAGGGAGGAAGGAAGG + Intronic
1198436434 X:136621342-136621364 TGGTGGGTAGAGGGGGAGGTGGG - Intergenic
1198500317 X:137238217-137238239 AAGTGGGTAGGCAGGAAGGGAGG - Intergenic
1198963805 X:142207582-142207604 GAATGGGTAGGGAGGTGGGTAGG - Intergenic
1199550656 X:149057501-149057523 TGGTGGAGAGGGAGGAAGGAGGG + Intergenic
1199617659 X:149670699-149670721 TGGTGGGGAGAGAGGAAGGAGGG - Intergenic
1199624984 X:149732550-149732572 TGGTGGGGAGAGAGGAAGGAGGG + Intergenic
1199825827 X:151498386-151498408 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199853589 X:151742038-151742060 TAGTGGGAATGGAGAAAGTTTGG - Intronic
1199871716 X:151904384-151904406 TGGTGGGGAGGGAGGAAGGAGGG - Intergenic
1199896000 X:152128252-152128274 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199896012 X:152128286-152128308 GTTTGGGAAGGGAGGAAGGTGGG + Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200015957 X:153164082-153164104 GTGTGGGAAGGGAGGAAGGTGGG - Intergenic
1200015966 X:153164115-153164137 TGGTGGGAAGAGAGGAAGGAGGG - Intergenic
1200082597 X:153585890-153585912 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201438458 Y:13985038-13985060 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438475 Y:13985100-13985122 TGGTGGGTCGGGAGGCAGGGAGG - Intergenic
1201438492 Y:13985154-13985176 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438611 Y:13985524-13985546 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201445962 Y:14057184-14057206 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446081 Y:14057554-14057576 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446098 Y:14057608-14057630 TGGTGGGTCGGGAGGCAGGGAGG + Intergenic
1201446115 Y:14057670-14057692 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic
1201965873 Y:19734808-19734830 TAAAGAGTAAGGAGGAAGGTAGG + Intronic