ID: 916961565

View in Genome Browser
Species Human (GRCh38)
Location 1:169894249-169894271
Sequence TAGCAAACAGTAGAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916961561_916961565 0 Left 916961561 1:169894226-169894248 CCAAAATGGCTGCTGGCCACTTG 0: 1
1: 1
2: 1
3: 39
4: 182
Right 916961565 1:169894249-169894271 TAGCAAACAGTAGAGGTGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 271
916961560_916961565 6 Left 916961560 1:169894220-169894242 CCAAATCCAAAATGGCTGCTGGC 0: 1
1: 0
2: 3
3: 89
4: 761
Right 916961565 1:169894249-169894271 TAGCAAACAGTAGAGGTGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 271
916961558_916961565 7 Left 916961558 1:169894219-169894241 CCCAAATCCAAAATGGCTGCTGG 0: 1
1: 0
2: 1
3: 30
4: 318
Right 916961565 1:169894249-169894271 TAGCAAACAGTAGAGGTGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 271
916961557_916961565 10 Left 916961557 1:169894216-169894238 CCGCCCAAATCCAAAATGGCTGC 0: 1
1: 0
2: 1
3: 31
4: 273
Right 916961565 1:169894249-169894271 TAGCAAACAGTAGAGGTGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916961565 Original CRISPR TAGCAAACAGTAGAGGTGCA GGG Intronic
900209175 1:1445153-1445175 TAGGAAACAGAAGAGGAGCCTGG + Intergenic
900219012 1:1497071-1497093 TAGGAAACAGAAGAGGAGCCTGG + Intronic
901752427 1:11418905-11418927 TAGCACAGAGGAGAGGAGCATGG - Intergenic
907096539 1:51786502-51786524 TAGAAAACAATAGAGGTGGATGG - Intronic
907110527 1:51922595-51922617 CTGGAGACAGTAGAGGTGCAAGG - Intronic
908309503 1:62863889-62863911 AAGCTAACAGGAGAGGTTCAGGG + Intronic
908709535 1:66999772-66999794 TAGAAAACAGTAATGGTGCCAGG + Exonic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
909285936 1:73817437-73817459 TAGATAAGAGTACAGGTGCATGG - Intergenic
912989169 1:114466731-114466753 CAGCAAAGAGAAAAGGTGCATGG - Intronic
916961565 1:169894249-169894271 TAGCAAACAGTAGAGGTGCAGGG + Intronic
917255086 1:173106727-173106749 TAGCACAAAGAAGAGGTGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918124701 1:181572814-181572836 TAGTAATTAGGAGAGGTGCATGG + Intronic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919087152 1:192933970-192933992 TTGCAAACTGTAGAAGTGGAAGG - Intergenic
920772565 1:208903262-208903284 TAGAAACAAGTAGAGGGGCAAGG - Intergenic
1062818975 10:519834-519856 TGGCAACAAGTAGAGGAGCAGGG - Intronic
1063274333 10:4548562-4548584 TAGCAAAAAGTGGAGCTACAGGG - Intergenic
1063444426 10:6100856-6100878 TAGCAAAAAATACAGGTGTAAGG + Intronic
1063536160 10:6885780-6885802 TAGCTAAGATTACAGGTGCATGG + Intergenic
1064633317 10:17339315-17339337 TAATAAACAGAAGAGGTGCCTGG - Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1067609202 10:47694997-47695019 TAGTAATCACTAGTGGTGCATGG - Intergenic
1067680622 10:48435982-48436004 TAGGAAACAGGAAAGGTCCAAGG - Exonic
1068248207 10:54401151-54401173 TAGCATAGTGTAGAGGTGAAAGG - Intronic
1070441788 10:76453391-76453413 TAACCCACAGTAGAGGTGAAGGG - Intronic
1072218774 10:93310020-93310042 CGGCAAAGAGTAGAGGAGCACGG + Exonic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1073141476 10:101251205-101251227 TAGCAAATAGGAGAGGAGCTGGG - Intergenic
1073999541 10:109355995-109356017 TATCAAACAGTAGAGGAGGAGGG - Intergenic
1078292387 11:10025753-10025775 TAGAAAACAGTAGCGGAGCATGG - Intronic
1078630337 11:12997302-12997324 CAGCAAACAATAGAGCTGGAGGG - Intergenic
1078811004 11:14763077-14763099 TAGAAAAGAGAAGAGGTCCAAGG + Intronic
1079395443 11:20058693-20058715 CTGCTAACAGTAGAGGTGCCAGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079700249 11:23537303-23537325 TGCCAAACAGTAGTGGTCCATGG + Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081487158 11:43539986-43540008 TAGCAAGGAGTAGGTGTGCAGGG + Intergenic
1081514140 11:43808267-43808289 TGGCAAAGAGAATAGGTGCATGG + Intronic
1083429574 11:62607114-62607136 GAGCAGACAGTAGAGGTCAAAGG + Intronic
1083801173 11:65047366-65047388 TAGCAATGAGTAAAGGTGCAGGG + Intronic
1084868252 11:72077973-72077995 AAGCAAACAGTAGACATACATGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1088233760 11:107700757-107700779 TTGAAAACAGTAGAAATGCAGGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088801655 11:113312655-113312677 TAGCAGACAGTGTAGGTGCCTGG - Intergenic
1090615164 11:128507587-128507609 CAGCAAACCCCAGAGGTGCATGG + Intronic
1090855452 11:130606667-130606689 AAGCAAAGAGCAGAGGTGAAGGG - Intergenic
1092172312 12:6381660-6381682 TAGCAAACATTTGTAGTGCAAGG + Intronic
1092730114 12:11523348-11523370 TAGACAACAGTAGTAGTGCAAGG + Intergenic
1093015128 12:14147781-14147803 CAGCAAACAATAGAGGCCCAGGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094483263 12:30901959-30901981 TAGTAAGCAGTAAAAGTGCAGGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1098140563 12:67446266-67446288 TGGCATACAGTAGATGTCCAAGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099751355 12:86777837-86777859 TAGGAAAAAGTAGCTGTGCAGGG + Intronic
1101608280 12:106267002-106267024 AAGAAAATAGAAGAGGTGCATGG + Intronic
1102364646 12:112321467-112321489 TATCAGACAATAGAGGTGCCTGG + Intronic
1104077920 12:125406912-125406934 TAGGATCCAGTAGAGGTCCAGGG + Intronic
1108301012 13:49076188-49076210 TAGTAAACAGCAGAGGAGCTGGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109494378 13:63148537-63148559 TAACAAAAACTAGTGGTGCAAGG + Intergenic
1109608687 13:64734117-64734139 AAGCAATGAGTAGAGGTGCATGG - Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112623121 13:101072626-101072648 TAGCACACAGTAGGAGTGCTGGG - Intronic
1113718531 13:112533368-112533390 TTGCAAACATGAGAGATGCATGG - Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115038732 14:28893565-28893587 TAGCAAACTCCAGAGATGCAGGG + Intergenic
1115316947 14:32034757-32034779 AAGCGAACATTAGAGCTGCAAGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1119980608 14:79076636-79076658 TAGAATACAGTAGAGGTGACAGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1122010894 14:98746049-98746071 TAGCAGCAAGCAGAGGTGCAGGG - Intergenic
1122948246 14:105024252-105024274 TAACCAAGAGAAGAGGTGCATGG + Intergenic
1124575026 15:30900525-30900547 TAGCTGAGATTAGAGGTGCATGG + Intergenic
1125108982 15:36008212-36008234 CAGCAAAAAATAAAGGTGCATGG - Intergenic
1125214574 15:37256050-37256072 TTTCAAAAAGTAGAGGTGGAGGG + Intergenic
1125983415 15:44025391-44025413 TAGCAAACAAAAGAGATGCATGG + Intronic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126774847 15:52091869-52091891 TAGCTGGCAGTACAGGTGCACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127136019 15:55924430-55924452 TGGCAATCAGAAGAGGTGCTTGG + Intronic
1127804114 15:62502853-62502875 TACCAAACAGTACAAGAGCAAGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129097777 15:73226490-73226512 TAACAAACAGAAGAGGTGCTAGG + Intronic
1129236630 15:74227596-74227618 TAGCCAACAGCAGTGGTTCAGGG - Intergenic
1131643638 15:94318604-94318626 TGGCCAACAGAAGAGGTCCAGGG - Intronic
1141274164 16:82570050-82570072 TAGCAAACAGAAGCGGTCCTGGG - Intergenic
1142346236 16:89555775-89555797 TAGAACTCAGGAGAGGTGCACGG + Intronic
1144115463 17:12085576-12085598 AATGAAACAGTAGAGGTGAAAGG - Intronic
1145726796 17:27135600-27135622 TAGCATAGTGTAGAGGTGAAAGG - Intergenic
1149137990 17:53393357-53393379 TATCAAAGAGTAAAGGTGCAAGG + Intergenic
1149246038 17:54709058-54709080 TATCAAACATTAGAGGTGAACGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153893785 18:9541236-9541258 TAGCTAGGATTAGAGGTGCACGG - Intergenic
1154173244 18:12066135-12066157 AAGCAAACAAAAGATGTGCATGG - Intergenic
1156747177 18:40406490-40406512 TAGAGAACTGTAGAGCTGCAAGG - Intergenic
1158456947 18:57616564-57616586 TAGCAACCAGCACAGGTACAAGG + Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165448652 19:35870039-35870061 TTGTAAAGAGTAGAGGTGTAGGG + Intronic
1166642425 19:44505191-44505213 TAGCAAAGGGAAAAGGTGCATGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925490177 2:4382841-4382863 TAGCATAAAGTAGAGGTGATAGG - Intergenic
927446687 2:23168882-23168904 CAGCAAACAGTTTAGTTGCAGGG - Intergenic
928333372 2:30374844-30374866 TAGAAAACAATGGAGATGCAGGG - Intergenic
928713850 2:34037426-34037448 TAGCAAACAGCAGAGTTCAATGG - Intergenic
928896587 2:36272398-36272420 GGGCAAAGTGTAGAGGTGCAAGG - Intergenic
930781299 2:55226760-55226782 TAGCTGAAACTAGAGGTGCAGGG + Intronic
931011937 2:57927405-57927427 TAGCTAGCATTACAGGTGCATGG + Intronic
934101282 2:88655594-88655616 CAGCAAAGAGAAAAGGTGCATGG - Intergenic
934699132 2:96424427-96424449 TAGCAAAGTGTGGTGGTGCATGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
937192055 2:120111716-120111738 TACCAGACAGTAGAGGAGCAAGG - Intronic
937989486 2:127654347-127654369 TAGCACACAGGAGAGGTGGCAGG + Intronic
938717085 2:134030537-134030559 TAGTAACAAGTAGAGGTGAAAGG - Intergenic
939380370 2:141427536-141427558 TAGCAAAAAGTGGAAATGCAGGG + Intronic
939450411 2:142366593-142366615 TAGCAAAGAGAAAATGTGCAAGG - Intergenic
940645373 2:156386969-156386991 TAGGAAACAGATGAGCTGCATGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941265603 2:163357895-163357917 TGGCAAAGGTTAGAGGTGCAGGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
944443641 2:199767655-199767677 TAGAAGAGAGAAGAGGTGCAAGG - Intronic
948259687 2:236594406-236594428 TAGCACACTGTTGAGTTGCAAGG + Intergenic
948995481 2:241576173-241576195 AAGAAAAGAGTAGAGCTGCAGGG - Intergenic
1170037989 20:12010491-12010513 TAGCAAACTGTAGAGAAACAAGG + Intergenic
1170559307 20:17542466-17542488 TAGCAGAGACTACAGGTGCATGG - Intronic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1176946903 21:14992938-14992960 TAGTTAAAAGTAGAGATGCAAGG - Intronic
1177156017 21:17502423-17502445 TAGCTTACAGTAGAGATGGAGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177809800 21:25914067-25914089 TAGAAAACAGGAAAGGTGGAAGG - Intronic
1178541647 21:33456608-33456630 TAGCAAACAATACAGCAGCATGG + Intronic
1179042439 21:37815946-37815968 AAGCAGACAGTAGAGGGGCAGGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1181677771 22:24468230-24468252 TACTAGACAGTACAGGTGCATGG + Intergenic
1184095602 22:42314660-42314682 GAGCAGACAGGAGGGGTGCAGGG - Intronic
1184675453 22:46039837-46039859 CATCGAACAGTAGAGGTGAAAGG + Intergenic
949688594 3:6607997-6608019 CAGCTAACAGGAGAGATGCAAGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950194038 3:10996375-10996397 TAGCAGACAGGAGAGTTGCCTGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
953023727 3:39132716-39132738 TAGCACACAGTAGGTGTCCAAGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957956988 3:87199941-87199963 TAGCAAATAGGATAGATGCATGG + Intergenic
958579961 3:96006332-96006354 TAAGAAACAGTAGAGGTTAAGGG + Intergenic
960304799 3:116047997-116048019 CATCAAACGGTAAAGGTGCATGG - Intronic
960520247 3:118646487-118646509 TAGTAAACAGTGGAGATGCTAGG - Intergenic
961156555 3:124684635-124684657 TAGCACACCTTAGACGTGCATGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963047653 3:141114794-141114816 TAGCAGACATTAGAGGTTTATGG - Intronic
964626606 3:158765802-158765824 TAGCAAAAGGCAGAGCTGCAGGG + Intronic
965495128 3:169388824-169388846 TAGCAAATACTAAAAGTGCAAGG - Intronic
968169086 3:196494134-196494156 TAGCAAACAGGCCAGGTGCGGGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
970844015 4:20514317-20514339 TAGAATGCAGTAGAGGTGCTTGG - Intronic
970959326 4:21854664-21854686 TAGCAAACATTAGAGATGACTGG - Intronic
971861144 4:32107630-32107652 CAGCAAACAATTGAGGTGAAAGG + Intergenic
972594854 4:40520575-40520597 TAGGAAATAGTAGAGGAGAAAGG + Intronic
972650895 4:41016727-41016749 TAGCAAGCAGAAGAGTTACATGG - Intronic
974019603 4:56681137-56681159 TGGAAAACGGTAGAGGTGAAAGG - Intronic
974441534 4:61924602-61924624 AAGGAAACAGTAGAGGTGGGAGG - Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974662769 4:64915838-64915860 TAGCAAATTGTAAAGGTACATGG + Intergenic
974827360 4:67148402-67148424 TGGCAAACATTATAGGAGCAGGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975430402 4:74283590-74283612 TGCCAAACAGTAGAGCTGAATGG - Intronic
975448877 4:74501041-74501063 TAGCAAAGACTGCAGGTGCAGGG + Intergenic
977256523 4:94747001-94747023 TAGCAACTAGTAGAGGAGAAAGG + Intergenic
977332240 4:95651875-95651897 TGGGAAAAAGTGGAGGTGCAAGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981023692 4:140054544-140054566 GTGAAAACAGGAGAGGTGCAAGG - Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
985163660 4:187070031-187070053 TAGCCATCAGTAGAGATGCAGGG - Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985622797 5:964375-964397 GAGCAAACAGCACAGGTGCATGG + Intergenic
986581406 5:9270292-9270314 TAGCAAAGACAAGAGGTGCATGG - Intronic
986882985 5:12198382-12198404 CAGGAAAGCGTAGAGGTGCAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990256260 5:53973611-53973633 TAGCAAAGACTATAGGTACATGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994121631 5:96120408-96120430 TTGCAAACAGGATAGGAGCAAGG - Intergenic
994567934 5:101476824-101476846 TAGCAAGCAGTAGATGTCCATGG - Intergenic
995204853 5:109467950-109467972 TAGCCAAGAGTGGTGGTGCATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995911611 5:117194361-117194383 TAGCACTAAGTAGAGGTGAAGGG + Intergenic
996632796 5:125656177-125656199 TACTAAAGAGAAGAGGTGCATGG + Intergenic
998767811 5:145507629-145507651 TTGCAAACACTAGAGGGCCATGG - Intronic
999242332 5:150135176-150135198 TATCAAACATTAGAGCTGGAAGG - Intronic
999692557 5:154161158-154161180 CAGCAAACAATAGAGCAGCATGG - Intronic
1000278188 5:159758154-159758176 TAGCGAACAGGAGATGGGCAGGG - Intergenic
1001032149 5:168270837-168270859 TATTAATCAGGAGAGGTGCAGGG + Intergenic
1003364190 6:5457016-5457038 TTGCACACAGTAGAGGATCACGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004681860 6:17903842-17903864 TAGAAAACAGTACAGTTGCCAGG + Intronic
1005586551 6:27281979-27282001 AAACAAACAGTAAAGGTGAAAGG + Intergenic
1006700015 6:35964668-35964690 TAGAAAACTGTAGATGTGCCAGG + Intronic
1008349288 6:50470993-50471015 GATCAAACAATAGAGGTACAAGG + Intergenic
1008829632 6:55742015-55742037 TAGCAAAGGGTATAGATGCAGGG + Intergenic
1009314885 6:62205640-62205662 AAGAAAAGAGTAGAGATGCAGGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1010366380 6:75056854-75056876 TAGCAATCAGGAGGGGTGCTTGG - Intergenic
1011934127 6:92753953-92753975 AAGCAAACAATAGAGGTGTTTGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1014303841 6:119715916-119715938 TAGCAAGAAGGAGAAGTGCAAGG - Intergenic
1014729603 6:125017042-125017064 AAGCAAAGAGAAAAGGTGCATGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016177961 6:141103779-141103801 AAGCAAATAGTATAAGTGCATGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017127394 6:151078882-151078904 TACCACACTGCAGAGGTGCAGGG + Intronic
1018339532 6:162836556-162836578 TACCAAAGAGTGGAGGTGGAGGG + Intronic
1018373429 6:163188814-163188836 TAGCATTCAGTAGAGGGGAAAGG + Intronic
1019871893 7:3771403-3771425 TTGCAAAGAGCAGAGGTACAGGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025159208 7:56638714-56638736 TAGAAAACAGAAGAAGAGCAGGG + Intergenic
1027795404 7:82687184-82687206 AAGGAAACAGTAGCCGTGCACGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028742333 7:94289899-94289921 CAGAGAACACTAGAGGTGCAAGG + Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1033862130 7:145641286-145641308 TTCCAAAAAGTAGAGGTGGAGGG - Intergenic
1033963766 7:146948124-146948146 TAGCAAACAGAATAGCTGCTTGG - Intronic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034717069 7:153253345-153253367 TAGCAAACTGTGGCAGTGCAGGG - Intergenic
1035022408 7:155807416-155807438 GAGCAAACTGAAGAGGTGGAGGG + Intronic
1036463054 8:8971297-8971319 TAGCAAAGTGGAGATGTGCAGGG + Intergenic
1037420850 8:18700767-18700789 AAGCAAACAGTAGAGTAGAAAGG + Intronic
1039345569 8:36701568-36701590 TAGCATAGAGTAGGGGAGCATGG - Intergenic
1041096069 8:54351456-54351478 AAGCAAACAGTATGGGTGGAGGG - Intergenic
1041327888 8:56688626-56688648 AAGAAAACAGAAGAGGTTCAAGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1046029243 8:108763653-108763675 TAGCACAAAGCAGATGTGCAAGG + Intronic
1046040079 8:108892564-108892586 CAGCAAACAGTACAAGTGAAAGG + Intergenic
1046560864 8:115835805-115835827 TAGGAAACAGCAGAGGAGCTGGG + Intergenic
1046920602 8:119724099-119724121 TAGCTAACACTACAGGTGCCTGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047327162 8:123851005-123851027 TAGCAAACAGAAGAATTCCAGGG - Intergenic
1047703495 8:127473609-127473631 TACCAAACAGGAGAGGAGGATGG - Intergenic
1048350405 8:133611377-133611399 TAGCAGAAAGGTGAGGTGCAGGG - Intergenic
1048426822 8:134330783-134330805 TAGCATAAACTAGAGGTTCATGG - Intergenic
1048534076 8:135276239-135276261 TAGCACACAAGAGAGGGGCAAGG - Intergenic
1048574726 8:135681527-135681549 CAGCACACACTAGAGCTGCAGGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049713150 8:144076289-144076311 CAGCAAAGAGAAAAGGTGCATGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053569502 9:39289058-39289080 TAGCACACAGTAGGCGCGCAAGG - Intergenic
1054823138 9:69543801-69543823 TAGCAAATTGGAGAGATGCATGG - Intronic
1055218199 9:73893785-73893807 TAGAAAACAGAACAGGTGAAGGG + Intergenic
1057456119 9:95213285-95213307 AAGCAAAAAGTAGAGATGAAAGG + Intronic
1059504655 9:114787387-114787409 CTGCAGACAGTAGAGGTGCTGGG + Exonic
1060904121 9:127289382-127289404 TAGCCAAGGGAAGAGGTGCATGG + Intronic
1062540425 9:137039564-137039586 AACCGAACAGGAGAGGTGCAGGG + Exonic
1062723892 9:138060394-138060416 TAGAAACCAGCAGAGGGGCATGG + Intronic
1187524868 X:20045224-20045246 TAGCAAATGGAGGAGGTGCATGG - Intronic
1188721437 X:33528123-33528145 TTGCTAACAGTAGAGGCTCAGGG - Intergenic
1188975625 X:36670884-36670906 TAGCAAATAGTGAATGTGCAAGG - Intergenic
1192116583 X:68417444-68417466 GAGCAAAAAGCAAAGGTGCAAGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193821903 X:86175095-86175117 TAGAAAAGAGTAGAGTTTCAAGG + Intronic
1200469244 Y:3561892-3561914 TAGCTAACAATGGAGGTGAATGG + Intergenic
1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG + Intergenic
1202378113 Y:24256200-24256222 TACAAAAAAGTAGAGGGGCATGG - Intergenic
1202492669 Y:25413921-25413943 TACAAAAAAGTAGAGGGGCATGG + Intergenic