ID: 916964005

View in Genome Browser
Species Human (GRCh38)
Location 1:169916584-169916606
Sequence ACGGAGACCCAGGATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916964005_916964012 -2 Left 916964005 1:169916584-169916606 CCCTCCTCATCCTGGGTCTCCGT No data
Right 916964012 1:169916605-169916627 GTTGCTGATGCTGGGTGCAGTGG No data
916964005_916964010 -10 Left 916964005 1:169916584-169916606 CCCTCCTCATCCTGGGTCTCCGT No data
Right 916964010 1:169916597-169916619 GGGTCTCCGTTGCTGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916964005 Original CRISPR ACGGAGACCCAGGATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr