ID: 916972674

View in Genome Browser
Species Human (GRCh38)
Location 1:170041540-170041562
Sequence CACAGGCAGATGCCTACGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916972674_916972680 5 Left 916972674 1:170041540-170041562 CCCCTCGTAGGCATCTGCCTGTG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 916972680 1:170041568-170041590 GTGACCTCTTAGCATTTCAGAGG 0: 1
1: 0
2: 1
3: 12
4: 116
916972674_916972683 26 Left 916972674 1:170041540-170041562 CCCCTCGTAGGCATCTGCCTGTG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 916972683 1:170041589-170041611 GGCCCGGAGATGAGTCCAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 99
916972674_916972682 10 Left 916972674 1:170041540-170041562 CCCCTCGTAGGCATCTGCCTGTG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 916972682 1:170041573-170041595 CTCTTAGCATTTCAGAGGCCCGG 0: 1
1: 0
2: 1
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916972674 Original CRISPR CACAGGCAGATGCCTACGAG GGG (reversed) Intronic
900497953 1:2984924-2984946 CACAGGCAGATGCATCTGAGAGG - Intergenic
902378535 1:16041795-16041817 CACTGCCAGGTGCCTAGGAGGGG - Intergenic
903211874 1:21823303-21823325 GGCAGGCAGGTGCCTACGAGGGG + Exonic
905035860 1:34918076-34918098 CACAGGCAGAACCCTCAGAGGGG + Intronic
906610701 1:47199988-47200010 CACAGGAAGACACCTACGAAAGG - Intergenic
908019613 1:59886514-59886536 CACTGGCAGATGCCCCAGAGTGG + Intergenic
909517953 1:76533521-76533543 GACAGGCAGAAGCCTCAGAGTGG - Intronic
913045906 1:115073332-115073354 CAGGGGCAGATGCCTTCCAGAGG - Intronic
915602268 1:156929743-156929765 CACAGGAAGATGCCACCCAGGGG - Intronic
916972674 1:170041540-170041562 CACAGGCAGATGCCTACGAGGGG - Intronic
917518879 1:175731890-175731912 AAGAGGCAGATTCCTACCAGAGG - Intronic
917583877 1:176405468-176405490 CACAGGCAGTAGCCAAGGAGTGG - Intergenic
918248951 1:182684734-182684756 CACAGACAGCTGCCTCCGAGGGG + Intergenic
920401906 1:205681245-205681267 CCCAGGAAGATGCCTTCGAAGGG + Intergenic
922169875 1:223144994-223145016 CACAGGCAGAGCCCTGCCAGAGG + Intergenic
923564043 1:235063381-235063403 CACAGCCAGATGCCTAGAAAAGG + Intergenic
1063379061 10:5572928-5572950 CACAAGCACATGCCAAGGAGAGG - Intergenic
1066648814 10:37636756-37636778 CACAGGCAGATGAAAAGGAGGGG + Intergenic
1067783102 10:49223259-49223281 CCCAGGCAGAAGCCTACCACAGG - Intergenic
1072073666 10:91946436-91946458 CTCAGGTAGATACCTAGGAGTGG + Intronic
1073583434 10:104687461-104687483 CACATTCAAATGCCTAGGAGAGG + Intronic
1077339521 11:2019852-2019874 CGCAGGCAGATCCCTACTACCGG - Intergenic
1082637784 11:55617661-55617683 CACACACAGAGGCCTACGGGGGG + Intergenic
1085598135 11:77829203-77829225 CACATGCATATGCCAAGGAGAGG + Intronic
1085798999 11:79570249-79570271 AACAGGAAGTTGCCTAAGAGAGG - Intergenic
1089160615 11:116434277-116434299 CACAGGCACATGCCATCAAGGGG + Intergenic
1089803169 11:121055429-121055451 GACATGCAGATGCCTATGATTGG + Intronic
1091180816 11:133602816-133602838 CTCAGGCAAATACCTAGGAGTGG + Intergenic
1202822506 11_KI270721v1_random:75041-75063 CGCAGGCAGATCCCTACTACCGG - Intergenic
1092193041 12:6533980-6534002 CTCAGGCAAAGGCCTAGGAGGGG - Exonic
1092959979 12:13587268-13587290 GAGAGGAAGATGCTTACGAGTGG - Intronic
1101999638 12:109548945-109548967 CACAGCCAGCTGCCTCCGACAGG + Intergenic
1102552215 12:113699771-113699793 CACAGGCAGAAGCCTGCAAATGG + Intergenic
1112277901 13:98037755-98037777 CACAGGCAGAGGCCTGGCAGTGG + Intergenic
1113940775 13:114017629-114017651 CACAGGCAGAGGCCGCAGAGGGG - Intronic
1114228217 14:20757754-20757776 CTTAGGCAGATGCCTATGGGTGG + Intergenic
1114969865 14:28012863-28012885 CACAGGCAGCTGCCCTCCAGTGG + Intergenic
1118472630 14:66089237-66089259 CCCAGGCAGCTGCCTTTGAGTGG - Intergenic
1122025846 14:98875382-98875404 CACAGGCAGACGCCCTGGAGAGG + Intergenic
1122102659 14:99425631-99425653 CACTGGCAGATGCCTAGAAATGG + Intronic
1122376135 14:101259787-101259809 CTCAGGCAAATACCTAAGAGTGG + Intergenic
1124434489 15:29635640-29635662 CACAGGGAGAGGCCTACACGGGG - Intergenic
1125609615 15:40961414-40961436 CACAGGCAGAGGCCTAGCAAGGG - Intergenic
1132066195 15:98733057-98733079 CACAGAAAGATGTCTACGTGTGG + Intronic
1132616899 16:845684-845706 CTCGGGCAGATACCTAGGAGTGG + Intergenic
1132665466 16:1079505-1079527 CACAGGCAGATGACCAGCAGCGG - Exonic
1132753431 16:1470014-1470036 CTGAGGCAGATGGCAACGAGGGG + Intronic
1138529873 16:57629247-57629269 CACAAGGAGATGCCTGGGAGGGG + Intronic
1141055764 16:80812367-80812389 CCCAGGCAGATGCTTATGAGTGG - Intergenic
1141418014 16:83891948-83891970 CAGGGGCAAATGCCTATGAGCGG - Intergenic
1141983926 16:87567297-87567319 CACAGGTAAAAGCCGACGAGGGG - Intergenic
1142111752 16:88335619-88335641 TCCAGGCAGATGCCTGGGAGGGG + Intergenic
1145256142 17:21323520-21323542 CACAGGCAGCAGCCTGGGAGGGG + Intergenic
1145320471 17:21764430-21764452 CACAGGCAGCAGCCTGGGAGGGG - Intergenic
1146849836 17:36212391-36212413 CAGAGGAAGATGCCTACCACAGG + Exonic
1150471975 17:65445173-65445195 CAAAAGCAGATGTCAACGAGTGG - Intergenic
1151451381 17:74200297-74200319 CACAGTCTGCTGCCTCCGAGAGG - Intergenic
1151473711 17:74333233-74333255 CACAGGCAGGTGGCTAAGCGGGG - Intronic
1153893848 18:9541615-9541637 CACAGGCAGATGCTGAGGGGAGG - Intergenic
1156275464 18:35579952-35579974 CTCAGGCATACGCCTAGGAGTGG + Intergenic
1157266205 18:46225015-46225037 CACAGGCAGTGGCCTAGAAGAGG + Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1165211782 19:34241659-34241681 CAGAGGCAGAAGCCTTCCAGAGG - Intergenic
925170780 2:1749172-1749194 CAAAGGCACATGCCCAGGAGGGG - Intergenic
926243444 2:11105018-11105040 CACAGGCCCATGCCGACGTGTGG + Intergenic
926641921 2:15246216-15246238 CACAGGCAAAGGCCTAAGAAAGG - Intronic
927516719 2:23675904-23675926 CACATGCAGATGCGTGCTAGGGG - Intronic
930754727 2:54962729-54962751 CAAACTCAGATGCCCACGAGTGG + Intronic
937885978 2:126900195-126900217 TACAGGCAGATGCCTCCAAGGGG - Intronic
939930675 2:148230041-148230063 CACAGGCTGAAGCCCAGGAGTGG - Intronic
940718789 2:157258774-157258796 CACAGGCAGTAGCAAACGAGAGG + Exonic
944286588 2:197957035-197957057 CACAAGCAAATGCCTATGAAGGG - Intronic
944407713 2:199404036-199404058 CACATGCAGATGCCAAAGAAGGG + Intronic
946310478 2:218880302-218880324 CACAGGAAGATGCCTGTGTGTGG - Intergenic
1171380841 20:24732863-24732885 CACTGGCAGATGTCTCCGTGTGG - Intergenic
1174127785 20:48319990-48320012 CTCAGGCAGAGGACCACGAGGGG - Intergenic
1174262795 20:49309042-49309064 CTTAGGCAGATACCTAGGAGTGG + Intergenic
1175568229 20:59997953-59997975 CACAGGCACATACCTGCCAGAGG - Intronic
1175815254 20:61880248-61880270 CCCAGGCAGATGCCTCTGGGTGG - Intronic
1178482523 21:32991881-32991903 CACAGGCAGAGGCCCGGGAGGGG + Intergenic
1179156881 21:38858679-38858701 CACAGGCAGCTGCCTGAAAGAGG + Intergenic
1179897460 21:44370649-44370671 CACTCCCAGATGCCCACGAGGGG + Intronic
1181902388 22:26167610-26167632 CACACACAGAGGCCTACCAGAGG + Intergenic
1182013028 22:27016404-27016426 CACAGGCAGCTGCCTACTTGGGG - Intergenic
1183483608 22:38077838-38077860 AAAAGGCAGATGCCAGCGAGGGG + Intergenic
1183928613 22:41223548-41223570 CACAGGCAGAGGGCTGGGAGGGG + Intronic
1185013699 22:48331460-48331482 TACAGGCAGATGCCCACGTACGG + Intergenic
956869013 3:73398192-73398214 CAGTGTCACATGCCTACGAGGGG + Intronic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
961825573 3:129597459-129597481 CGCAGGCAGAGGCCTTGGAGTGG - Intronic
963773658 3:149416241-149416263 CACATGCAGAGGCCTACATGTGG + Intergenic
965972618 3:174580835-174580857 CTCAGGGAGATACCTAAGAGTGG + Intronic
968658236 4:1787745-1787767 AGCAGGCAGCTGCCCACGAGAGG - Intergenic
969392489 4:6900948-6900970 GACAGGCAAATGTCTAGGAGAGG + Intergenic
971523176 4:27581273-27581295 CACAGAAAGATGGCTACCAGAGG - Intergenic
978206858 4:106090088-106090110 CCCAGGCAGAAGCCTACTACAGG - Intronic
985487378 5:159044-159066 CACAGGCAGAAGGCTGGGAGTGG - Intronic
985515507 5:342872-342894 CACAGGCATGTGCCTCCCAGCGG - Intronic
985588614 5:753484-753506 CACAGGCAGGTGGCAAGGAGAGG - Intronic
985603283 5:845923-845945 CACAGGCAGGTGGCAAGGAGAGG - Intronic
991321917 5:65383622-65383644 CACAGGCACATGACTACAATTGG - Intronic
994457168 5:100025669-100025691 CACACACACATGCCTATGAGGGG - Intergenic
994734100 5:103531072-103531094 CACAGGCAGGTGCCTGCTTGAGG - Intergenic
995758247 5:115535733-115535755 CTCAGGCACATACCTAGGAGTGG - Intronic
996985588 5:129559454-129559476 CACAAGCAGATTTCTACCAGTGG + Intronic
1002443725 5:179277167-179277189 CACAGCCAGAAGCCTCCAAGCGG + Intronic
1002759425 6:190250-190272 CACACACAGATGCCTATGAAAGG - Intergenic
1007399424 6:41595302-41595324 CACAGGCAGATGCCAGCCAACGG + Intronic
1012125091 6:95418881-95418903 CTCATGCAGATGCTTACTAGAGG + Intergenic
1016891684 6:149014064-149014086 CTCAGGCAGAAGCAGACGAGAGG + Intronic
1017630106 6:156388799-156388821 CACAGTCAGATGCCTTCCTGGGG - Intergenic
1018390567 6:163338009-163338031 CTCAGGGAGATGCCCAAGAGGGG - Intergenic
1020592348 7:10156843-10156865 AACTGGCAGGTGCCTAAGAGGGG - Intergenic
1020730986 7:11879790-11879812 CACAGGTACATACCTACTAGAGG - Intergenic
1024580209 7:50794564-50794586 TAGAAGCAGGTGCCTACGAGGGG - Intergenic
1031964721 7:128019420-128019442 CACAGGCTGTTGCTTAGGAGTGG + Intronic
1036561883 8:9905392-9905414 CACAGGCAGATGAATAAGGGGGG + Intergenic
1039903521 8:41769252-41769274 GACAGGCTGCTGCCTTCGAGAGG - Intronic
1049719703 8:144110104-144110126 CACTGGCAGGTACCTGCGAGTGG - Exonic
1051572715 9:18578543-18578565 CAAAGGCACATGCCAATGAGTGG - Intronic
1052173057 9:25425797-25425819 CACAGGCAGAAGCCTGTTAGAGG + Intergenic
1053458295 9:38248701-38248723 CACACGCAGATGCCTGTGATGGG - Intergenic
1056670448 9:88623277-88623299 CCCAGGCAGATGCCTGCAACAGG - Intergenic
1057921016 9:99096908-99096930 CACAGGCAGAAGCCTAGTGGAGG + Intergenic
1061991299 9:134160172-134160194 CACAGGTATATACCTAAGAGTGG - Intergenic
1062176084 9:135163863-135163885 AAGAGCCAGATGCCTGCGAGAGG + Intergenic
1062431361 9:136528209-136528231 CACAGGCAGAGGCCGAGCAGAGG + Intronic
1062653009 9:137587972-137587994 CACAGGCACATGGCTCCCAGGGG + Intronic
1197984216 X:132250193-132250215 CACAGGCAGTTCCCTATGAATGG - Intergenic
1198925500 X:141787801-141787823 CACAGGCAGAAGCCAGGGAGTGG - Intergenic