ID: 916974949

View in Genome Browser
Species Human (GRCh38)
Location 1:170066179-170066201
Sequence TATAACATAAAGAATGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916974949 Original CRISPR TATAACATAAAGAATGGGGG GGG (reversed) Intronic
900840134 1:5042115-5042137 AATTACATAAAGAATGGGGTTGG - Intergenic
902071659 1:13744769-13744791 TCAAAGATAAAGACTGGGGGAGG - Intronic
903722580 1:25416551-25416573 TAAAACATAAAGGCTGGGTGCGG - Intronic
905765085 1:40593763-40593785 TACAACATAAAGGATGTGGTTGG - Intergenic
905767877 1:40617799-40617821 AATAACATAAGGAATGGGACAGG - Intergenic
907146933 1:52243316-52243338 GATAATATAAAAAATGGGGGTGG + Intronic
908520718 1:64938889-64938911 TATAACATTAAGAATGCCAGGGG - Intronic
908895263 1:68891580-68891602 TAGAAAATATAGATTGGGGGAGG - Intergenic
909535180 1:76728017-76728039 TATAACAAAATGAATGGTAGAGG - Intergenic
910124891 1:83829679-83829701 TGGAAGATAAAGAGTGGGGGTGG - Intergenic
910247782 1:85160658-85160680 AATAGCACAAAGAATGAGGGGGG - Intronic
911081671 1:93939119-93939141 TATAATAAAAAAAAGGGGGGGGG - Intergenic
911276255 1:95862985-95863007 TATAGCACAAAGGATGGGAGGGG - Intergenic
912017451 1:105059955-105059977 TAGAACAGAAAGAAAGGGAGAGG + Intergenic
914344985 1:146791283-146791305 TATAACAGAAATAATGGAAGAGG - Intergenic
915507233 1:156365747-156365769 TCCAACATAAACACTGGGGGTGG + Intronic
916008636 1:160684496-160684518 ATTAATATAAAGAATGGGGCAGG - Intronic
916386433 1:164276877-164276899 AATAATATAAAGAATGAGAGGGG + Intergenic
916974949 1:170066179-170066201 TATAACATAAAGAATGGGGGGGG - Intronic
917862423 1:179159821-179159843 TAAAACATAAAGGCTGGGTGTGG + Intronic
919392737 1:197007514-197007536 TATAACATAAAGACTTGGCAAGG + Intronic
921091456 1:211847683-211847705 TGTAATATAAAGACTAGGGGAGG - Intergenic
922303944 1:224328068-224328090 TATAACTAAAAAAAAGGGGGGGG - Intronic
923915947 1:238505129-238505151 AATTTCAAAAAGAATGGGGGAGG + Intergenic
924139285 1:241005128-241005150 GTCACCATAAAGAATGGGGGAGG - Intronic
1062851022 10:743477-743499 GATACCATAAAGAATGTGGGCGG + Intergenic
1063046451 10:2397498-2397520 AATAATTTTAAGAATGGGGGAGG - Intergenic
1063109638 10:3023681-3023703 TATAAGATGAAGAATAGGTGAGG - Intergenic
1063472326 10:6298053-6298075 CAGAACAGAAAGAAGGGGGGAGG + Intergenic
1064579111 10:16775503-16775525 GACAACAAAAGGAATGGGGGTGG + Intronic
1065551270 10:26870628-26870650 AATAAAAGAAAGAAAGGGGGAGG + Intergenic
1065951500 10:30655751-30655773 TATAACATAATGAATGCTTGGGG + Intergenic
1067130727 10:43562933-43562955 TATATGAAAATGAATGGGGGAGG + Intronic
1067936533 10:50617060-50617082 TATAATAAAAAAAATTGGGGGGG + Intronic
1068164415 10:53309847-53309869 TATAATAATAAGAATAGGGGAGG - Intergenic
1068391269 10:56400259-56400281 TATAATTTCAAGCATGGGGGTGG + Intergenic
1070395732 10:76009992-76010014 TATAACAGAGAGAAGGCGGGTGG - Intronic
1070652726 10:78249641-78249663 TTTAACATACAGAATAGGGTAGG - Intergenic
1071038689 10:81280374-81280396 TTTAAAATAAACAATGGGAGTGG + Intergenic
1072065588 10:91867414-91867436 TACAACATAAAGAATAGGGGAGG + Intergenic
1072660263 10:97359645-97359667 AAAAACATGAGGAATGGGGGTGG - Intronic
1072925490 10:99613199-99613221 CATGACAAAATGAATGGGGGTGG - Intronic
1073165439 10:101444985-101445007 TATTACACAATGAATGGGGCAGG + Intronic
1073495519 10:103887539-103887561 TATAACATTATGAAGCGGGGTGG + Intronic
1073821632 10:107271008-107271030 TTTAACATATAAAATGAGGGAGG + Intergenic
1073835512 10:107436601-107436623 TAAAATAGAGAGAATGGGGGCGG + Intergenic
1075419371 10:122289254-122289276 AATAAGAGAAAGGATGGGGGAGG + Intronic
1077088272 11:765521-765543 AACAACAAAAAAAATGGGGGTGG - Intergenic
1079520864 11:21324970-21324992 TATAAAACAAAGATGGGGGGAGG - Intronic
1080261582 11:30355059-30355081 AAAAACATAAACAATGGTGGAGG - Intergenic
1082781190 11:57288798-57288820 TATAAAACTAAGACTGGGGGAGG + Intergenic
1082920726 11:58490619-58490641 CATAGCCTAAAGAATAGGGGAGG - Intergenic
1083482031 11:62955366-62955388 CATAAGAAAAAGTATGGGGGGGG + Intronic
1083584322 11:63845686-63845708 TATAACAAAAAGGAAGGGGGCGG - Intronic
1085430823 11:76445840-76445862 TATGACATAAAGAAAAGGGGTGG - Intronic
1085751572 11:79166935-79166957 TAGAACATAAAGCAGGGGAGTGG + Intronic
1087134203 11:94698671-94698693 GATAACATAAAGGATGAGGAGGG + Intergenic
1087175741 11:95093245-95093267 TAGAACATAAAATATGAGGGTGG - Intronic
1087335351 11:96837330-96837352 TCTATCAAAAAGAATGTGGGTGG + Intergenic
1088028931 11:105222496-105222518 TATTACACTGAGAATGGGGGAGG - Intergenic
1089110135 11:116049039-116049061 TTTAAAATAAAGAAGAGGGGAGG - Intergenic
1090252250 11:125259852-125259874 TAAAAAAAAAAGAATGGGGGTGG - Intronic
1095351877 12:41223090-41223112 TCTAATATAAAGAATGGGTAAGG + Intronic
1095373125 12:41493887-41493909 TATTAAAAAAATAATGGGGGGGG + Intronic
1095638794 12:44463112-44463134 AATAACACAAAAAATGGGAGGGG + Intergenic
1095753840 12:45740722-45740744 TACAAGATAATGAATGGGGTTGG - Intronic
1095916402 12:47484599-47484621 TATATAATAAAGAATTTGGGTGG + Intergenic
1096061242 12:48702487-48702509 TAAAAAATAAAGAATGGGCCGGG + Intronic
1096447198 12:51704292-51704314 TATGACATAAAGGATAGTGGGGG - Intronic
1097337768 12:58403602-58403624 TTTAACATAGAGAATGAGGTGGG - Intergenic
1097583939 12:61492674-61492696 TATAAAATAAAGGAAGGAGGAGG + Intergenic
1098423186 12:70326663-70326685 TAAAACATAAAGAATGGCACTGG - Intronic
1098934483 12:76462649-76462671 TATAGCATAAAAACTAGGGGGGG + Intronic
1099201415 12:79681484-79681506 TATAACTTCAAAAATAGGGGTGG - Intronic
1099983861 12:89640214-89640236 TTTAAAAAAAATAATGGGGGTGG - Intronic
1100336484 12:93635340-93635362 TAGATCATATAGAATGGGAGTGG - Intergenic
1103486474 12:121286332-121286354 TAAAACATCAAGGATGGGGCAGG + Intronic
1105957731 13:25300384-25300406 TTTAACATATGGATTGGGGGAGG + Intergenic
1106313115 13:28570940-28570962 TAAAACATAAAGAATCTGGCTGG - Intergenic
1106650676 13:31686925-31686947 TATAACTGAAAGATTGAGGGAGG - Intergenic
1106879237 13:34111381-34111403 TATAACATATGGAAAGGGGGTGG - Intergenic
1108142621 13:47440898-47440920 TATAACATTAAAACTTGGGGTGG + Intergenic
1109873916 13:68373002-68373024 TTTAACATAATGAATGGAGGAGG + Intergenic
1110212914 13:72993888-72993910 AATAACAAACAGAATGAGGGAGG + Intronic
1110342777 13:74413073-74413095 TATAAAATAAAGAATGGGGCTGG - Intergenic
1112244374 13:97717225-97717247 TATAAAATAATAGATGGGGGGGG - Intergenic
1115002609 14:28440445-28440467 CATCACATAAAGAAGGGAGGGGG + Intergenic
1115378015 14:32700076-32700098 TAACACTTAGAGAATGGGGGAGG - Intronic
1120568973 14:86093986-86094008 TAAAAGATAAACAATGAGGGAGG - Intergenic
1120606851 14:86590265-86590287 TCCAACTTAAAGACTGGGGGTGG + Intergenic
1121480238 14:94262552-94262574 TGTAACATGAAGAATGGGTGTGG - Intronic
1124505213 15:30266794-30266816 TAAAAGATACAGAATGGGGCCGG + Intergenic
1124738339 15:32271841-32271863 TAAAAGATACAGAATGGGGCCGG - Intergenic
1124932838 15:34138789-34138811 TATAGAATAAAAAAGGGGGGAGG + Intergenic
1126472528 15:49029142-49029164 TAGAACATATAGACTGGGCGAGG - Intronic
1127139835 15:55963550-55963572 TATAACATAAAGGATGGAGCAGG - Intronic
1127706332 15:61550579-61550601 TTTAAGAAAAAGAATGAGGGAGG - Intergenic
1127751317 15:62047599-62047621 TCTAATACAAAGAATAGGGGAGG + Intronic
1128432963 15:67617239-67617261 AATTAAAGAAAGAATGGGGGAGG - Intronic
1128474248 15:67983617-67983639 AATAAAATAAAGAATGTGGCTGG + Intergenic
1128540859 15:68531129-68531151 AATAGCATAAAGGATGGGTGGGG - Intergenic
1128808092 15:70548871-70548893 TTTAACACAAAGGATGGGAGTGG + Intergenic
1129174316 15:73829167-73829189 CATAATATAGAGAATGGGGGAGG + Intergenic
1129500389 15:76031389-76031411 TAAAACATAAAAATTGGGGCTGG + Intronic
1130092156 15:80830058-80830080 TATAACATAAAAACTGGGTTAGG - Intronic
1131718065 15:95135133-95135155 TATAACATAGGGACTGGAGGAGG + Intergenic
1131723420 15:95196576-95196598 AATAAAATAAAAACTGGGGGTGG + Intergenic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1134537444 16:15037532-15037554 TATAGCAGATAAAATGGGGGAGG + Exonic
1135229158 16:20689089-20689111 AATAACATAAAGTGTGGGGAGGG + Intronic
1137399624 16:48142650-48142672 TATAATATAAAGAATGGGGAAGG - Intronic
1138478405 16:57285173-57285195 TATAAAATACAGACGGGGGGAGG - Intergenic
1139989007 16:70924021-70924043 TATAACAGAAATAATGGAAGAGG + Intronic
1140646175 16:77032425-77032447 CATAATATAAAGACTGAGGGTGG - Intergenic
1140801738 16:78494766-78494788 CATACCATAAAGATGGGGGGAGG - Intronic
1141535584 16:84677592-84677614 TATTACACACAGAACGGGGGGGG + Intergenic
1143948202 17:10612781-10612803 TGTAAAATAAAGAGGGGGGGGGG - Intergenic
1144236897 17:13270566-13270588 TATAACATACAAAATGTGGCTGG + Intergenic
1144504286 17:15817115-15817137 TATCACATGCACAATGGGGGGGG - Intergenic
1145168142 17:20632624-20632646 TATCACATGCACAATGGGGGGGG - Intergenic
1146429783 17:32781258-32781280 CATAACAGAGAGAATGGTGGAGG + Intronic
1146772733 17:35583730-35583752 TAAATCATAAGGAATGGAGGAGG - Intronic
1146967042 17:37040748-37040770 TATAAAAGAAAGCGTGGGGGGGG - Intronic
1148817016 17:50335712-50335734 TAAAAAACATAGAATGGGGGTGG - Intergenic
1149284697 17:55149575-55149597 TATAAAATAAGGAAGGGGAGGGG - Intronic
1149432354 17:56604514-56604536 TATAAGACAAAGAATGGGTGAGG + Intergenic
1150681229 17:67286130-67286152 AATAAAATAAAGAATGGGTTAGG + Intergenic
1153342018 18:3984988-3985010 TTTAACAAAAACAATGAGGGTGG - Intronic
1157067402 18:44367410-44367432 TAAAACATAATGACTGCGGGTGG - Intergenic
1161557551 19:4952717-4952739 TGTAACATAAAGAATGTGAAAGG + Intronic
1161762725 19:6186308-6186330 CAACACATAAAGAATGGGTGTGG + Intronic
1163436535 19:17299237-17299259 AATTATATAGAGAATGGGGGGGG - Intronic
1165610624 19:37149143-37149165 TATAACCTATAGACTTGGGGTGG + Exonic
1166403012 19:42497856-42497878 TAATACAAAAAGAGTGGGGGAGG - Intergenic
1166692676 19:44833165-44833187 TATATCAGAAAGAATTGGGTCGG + Intergenic
1168454976 19:56499769-56499791 GATAACATAAAGGATTGTGGAGG - Intergenic
924986828 2:278842-278864 TAAAACATAAAAAATGGGGAAGG + Intergenic
927077017 2:19588912-19588934 TATAAGATAGGGAATGGGGAGGG - Intergenic
928012287 2:27621086-27621108 AAGAACATAAAGAAAGGTGGAGG - Intronic
929385155 2:41398008-41398030 TTTAAGAAAAAGATTGGGGGTGG + Intergenic
930006274 2:46899603-46899625 TTTAAGAAAAAGCATGGGGGAGG + Intergenic
930607248 2:53505330-53505352 TATAACTGGGAGAATGGGGGTGG - Intergenic
931565360 2:63610397-63610419 TAAAACATAAAGAAGGAGTGGGG + Intronic
931972896 2:67609682-67609704 CATCACATAAAGAATGGGTAGGG + Intergenic
932727558 2:74192646-74192668 TTTTACATAAACAATAGGGGAGG + Intergenic
932994927 2:76840146-76840168 TATAACGTGAAGACAGGGGGAGG + Intronic
933074301 2:77903926-77903948 TATGAGAAAAAGAATAGGGGTGG - Intergenic
933086599 2:78061194-78061216 TACAACACCAGGAATGGGGGAGG - Intergenic
933896701 2:86817146-86817168 AATAACATCAAGCATGAGGGAGG + Intronic
935713933 2:105923374-105923396 TATTAAATAAAGAATGCTGGAGG + Intergenic
936040646 2:109146791-109146813 GAAAACAGAAGGAATGGGGGGGG - Intronic
936434714 2:112494309-112494331 TATAACAGAAAGAAAGAGGATGG + Exonic
937049419 2:118876230-118876252 CAGAACATGAAGAATGGTGGCGG - Intergenic
937464123 2:122114956-122114978 TATAACCTAAAGAAAGAGGGAGG - Intergenic
937710984 2:124979725-124979747 TAAAACATACAGACTGGGGCTGG + Intergenic
939780742 2:146444587-146444609 TCTACCATAAATTATGGGGGTGG + Intergenic
939951884 2:148484818-148484840 TATAATATAAAGTGTGGGGATGG + Intronic
940969819 2:159883807-159883829 TATAAAATAAAGAATCTGAGGGG - Intronic
941018543 2:160384285-160384307 TATAGCATAGAGATTTGGGGTGG + Intronic
941224127 2:162824242-162824264 TTTAAAATAAAGAATGTTGGTGG + Intronic
942128703 2:172855336-172855358 AATAACATAAAGCATTGGGAGGG - Intronic
942365870 2:175226974-175226996 TAAAAAATAAAGACTGGGCGCGG + Intergenic
942454991 2:176131289-176131311 TAAAACAAAAAAAAAGGGGGGGG - Intronic
945052384 2:205836377-205836399 GCTAACAAAAAGAATAGGGGAGG + Intergenic
945297916 2:208189344-208189366 TATACCATATTGAATGGTGGTGG - Intronic
945548405 2:211187652-211187674 TACAACAGAAAGAATGGGTTTGG - Intergenic
946638622 2:221758299-221758321 TAGAACATAAAGGAAGTGGGAGG - Intergenic
947974118 2:234349641-234349663 TAAAACATAAAGTATGTGTGGGG - Intergenic
949061898 2:241965131-241965153 TATAACTTAAAGAATGGTTAAGG - Intergenic
1168730597 20:76254-76276 AGAAACATAAAAAATGGGGGTGG + Intergenic
1170435323 20:16320760-16320782 TATAACTTAAAAAATTTGGGAGG + Intronic
1170441996 20:16388768-16388790 TATACCATAAAGAAGGAGGGAGG + Intronic
1175380720 20:58560738-58560760 TATAAAATAAAGACTTTGGGGGG - Intergenic
1180287488 22:10762277-10762299 AATAACCAAAAAAATGGGGGTGG - Intergenic
1180970706 22:19813702-19813724 AATAAAATAAAGACTGGGTGCGG + Intronic
1184574291 22:45349768-45349790 TCTAAAACAAAGAATGGGGCAGG + Exonic
949744454 3:7272166-7272188 CATGACATAAAGAAGGGGTGGGG - Intronic
951585748 3:24213029-24213051 TATGACATGAACAATGGGAGTGG + Intronic
952909730 3:38172856-38172878 TATAACAAGAAGACTGGAGGTGG + Intronic
952985296 3:38774213-38774235 GAAAACATAAAGAGTGTGGGGGG - Intronic
955780982 3:62484282-62484304 AATAACATAAAGAATCAAGGAGG + Intronic
956538534 3:70307505-70307527 TATAACATAGAAATTGGGGGGGG - Intergenic
956679638 3:71766385-71766407 GATAACATACAGAATGTGGCTGG + Intergenic
956754944 3:72375897-72375919 GATAAATTAAAGAATGGGGAGGG - Exonic
959817660 3:110693670-110693692 GAAAACATAAAGAAAGGTGGGGG + Intergenic
960066609 3:113380594-113380616 TAGTACCTAAAGAATGGGAGGGG - Intronic
961444906 3:126975792-126975814 CATTACATCAGGAATGGGGGAGG + Intergenic
961639271 3:128354760-128354782 TATAACCAAAAGAAAGGAGGGGG + Intronic
961971654 3:130974640-130974662 TATATCATAAAGATGGGGAGGGG + Intronic
962114346 3:132486465-132486487 CATAACATGAAGCTTGGGGGAGG + Intronic
964578359 3:158200779-158200801 TATAGAATAAAGCATGGGGCAGG - Intronic
965254878 3:166393577-166393599 TAAAATATACAGAATGGGCGGGG - Intergenic
966544584 3:181131463-181131485 TGAAACATAAAGAAGGGGTGAGG + Intergenic
970182761 4:13416624-13416646 TAAATAATTAAGAATGGGGGTGG + Intronic
970847633 4:20561107-20561129 TATAACACAAAGAGGGGAGGAGG + Intronic
971326153 4:25645491-25645513 TTCAACATAAATATTGGGGGAGG + Intergenic
971529957 4:27674757-27674779 TATAAAATAAAAAATAGAGGGGG + Intergenic
972161125 4:36228741-36228763 TGAAACTTAAAGAATGGGGATGG + Exonic
974351693 4:60755832-60755854 TATCACATAAGCAGTGGGGGAGG + Intergenic
974964592 4:68745714-68745736 TATAAGATGTAAAATGGGGGTGG + Intergenic
975260651 4:72293749-72293771 TCTAACATAAATGATGGAGGTGG + Intronic
975598849 4:76078339-76078361 TATAATGTAAGGAATGTGGGAGG + Intronic
977157096 4:93588209-93588231 TATAAAAAGAAGAAAGGGGGAGG + Intronic
977718706 4:100213134-100213156 TCTCAGATAAAGAATGGGTGGGG - Intergenic
977828041 4:101556489-101556511 TATAAAATAAAGAATGGGCCAGG - Intronic
978235359 4:106451706-106451728 TATAAAAGAAAGAATGGGGTGGG - Intergenic
978581959 4:110240711-110240733 TATAGAATGAAGGATGGGGGTGG + Intergenic
978688082 4:111472625-111472647 TATATCATAAAAAATGGGGTAGG + Intergenic
981332438 4:143527523-143527545 TTTAACATAAAGAAAGGAAGAGG - Intronic
982430030 4:155312402-155312424 CATAATATAAATAATGGGTGTGG - Intergenic
983649306 4:170022768-170022790 TACAAAACAAGGAATGGGGGTGG + Intronic
983769668 4:171533926-171533948 TAAAACACAAAGAATGGAGTAGG + Intergenic
984469241 4:180144875-180144897 TACAAGATGAAGAATGGAGGGGG - Intergenic
986454191 5:7899222-7899244 TTTAACATAAAGATTTGGAGAGG + Intronic
987163361 5:15168473-15168495 TAGAACAGAAACAATGTGGGTGG - Intergenic
988447655 5:31305735-31305757 AATGACTTAAAGTATGGGGGAGG - Intronic
988668322 5:33354292-33354314 TATAACACAAATCATGGGGGAGG - Intergenic
989955604 5:50355813-50355835 TATAACTTAAATAATTGGGCAGG - Intergenic
990147439 5:52778558-52778580 TATAACCTAAACAAAGTGGGGGG - Intergenic
991565003 5:67996291-67996313 TATAGCAAAAAAAAGGGGGGGGG + Intergenic
991949590 5:71934331-71934353 TATAACATAAAGGGAGGAGGAGG - Intergenic
992234348 5:74693855-74693877 TACTACATAAAGCATGGGAGAGG + Intronic
992462342 5:76972884-76972906 TATCACAGAAAGAATGTGGGTGG + Intronic
992962894 5:81972785-81972807 TATAAAATCAAGAATTGGCGGGG + Intronic
993368866 5:87067223-87067245 TATATTATAAAGATTGGGGCTGG - Intergenic
994144179 5:96374239-96374261 AATAAAATAAAGAAAGAGGGAGG - Intergenic
994893860 5:105675294-105675316 AATAACAAAAAAAGTGGGGGAGG + Intergenic
997319934 5:132969673-132969695 TATAAAATAAATAATGGAGATGG - Intergenic
997404553 5:133634588-133634610 TTTAACAGGAAGAATGGGGTGGG + Intergenic
998675547 5:144403883-144403905 TCTACCAAATAGAATGGGGGTGG - Intronic
999072266 5:148757807-148757829 AATAACATAAAGTGTGTGGGAGG - Intergenic
999260416 5:150235119-150235141 TATAATATCCAGAATTGGGGAGG - Intronic
999495983 5:152097504-152097526 TATATAATAAAGAGTGGGGTGGG - Intergenic
999793495 5:154965767-154965789 TTTGATATACAGAATGGGGGAGG + Intronic
999997704 5:157107861-157107883 TTTCACATAAAAAAGGGGGGGGG - Intronic
1000969207 5:167695316-167695338 TAAAACGTAAGGAATGGGTGTGG + Intronic
1001653603 5:173331582-173331604 TAGACCATGAAGGATGGGGGAGG + Intergenic
1001783529 5:174391491-174391513 TATAATTTAAAGAATGGAAGAGG + Intergenic
1002104482 5:176873345-176873367 TTTAATTGAAAGAATGGGGGAGG - Intronic
1003365226 6:5467588-5467610 TATAACATGTAGCATGGTGGGGG - Intronic
1003743116 6:8965822-8965844 TGTAACATAAAGAATGGTGCAGG - Intergenic
1006185171 6:32177491-32177513 TACAACATTAAGAAAGGGGTGGG + Intronic
1006222477 6:32504155-32504177 TATAACATAAAGACTGCTGAAGG - Intergenic
1006329818 6:33382377-33382399 TGGAACACAAAGAATGGGGGCGG + Intergenic
1006828683 6:36955615-36955637 GATATCATACTGAATGGGGGAGG + Intronic
1007759372 6:44124196-44124218 AAAAAGTTAAAGAATGGGGGTGG + Intronic
1008259099 6:49343032-49343054 GCAAACATAAAGAATGGGGAAGG + Intergenic
1010470506 6:76221793-76221815 TATATGAAAATGAATGGGGGAGG - Intergenic
1013661051 6:112297357-112297379 TATTACATAAAGGGTGGGTGGGG + Intergenic
1014003898 6:116395423-116395445 TAAAAAATAAAGAAAGTGGGAGG + Intronic
1014367835 6:120566289-120566311 TGAAACACAAAGGATGGGGGGGG - Intergenic
1014405911 6:121050531-121050553 TATAATAAATAGAATGGGTGAGG - Intergenic
1016719093 6:147272632-147272654 TAGAACATAAATATTAGGGGAGG - Intronic
1017226156 6:152023168-152023190 TATAAAAGAGAAAATGGGGGTGG + Intronic
1020352419 7:7235752-7235774 TATAAAAGAAAGAATAGAGGAGG - Intronic
1020874501 7:13676487-13676509 AAGAAGATAAAGAAAGGGGGAGG - Intergenic
1021226445 7:18033581-18033603 TAAAATAAAAAGAATGAGGGTGG - Intergenic
1022269425 7:28791873-28791895 TACAACACAAGTAATGGGGGTGG - Intronic
1022643682 7:32211575-32211597 TATAATAAAAAAAAAGGGGGGGG + Intronic
1025489066 7:61088956-61088978 TATCTCAAAAAGAATGGGTGGGG - Intergenic
1026595041 7:71727327-71727349 TATGACCTAGAGAATGGGAGTGG + Intergenic
1027438049 7:78187421-78187443 TAAAACATTCAGAATGGGGGAGG - Intronic
1028424468 7:90670994-90671016 AAAAAAATAAAGAATAGGGGAGG + Intronic
1028758927 7:94472524-94472546 TATCACATAAAGGATAGGTGGGG + Intergenic
1029412679 7:100425743-100425765 TTTAGCATGAAGAATGGTGGTGG - Intronic
1029937271 7:104440021-104440043 TATAATACAAAGCCTGGGGGGGG + Intronic
1030845738 7:114408429-114408451 TATAACATAATGAATGGGCCAGG + Intronic
1031023830 7:116658686-116658708 TGTAAAAAAAAGAAGGGGGGTGG + Intergenic
1031089252 7:117333891-117333913 TCTAACAAAAAAAATGGAGGGGG + Intergenic
1031230515 7:119100053-119100075 GATACCATAATCAATGGGGGAGG - Intergenic
1032217686 7:129970243-129970265 TCTCAGATAAAGAATGTGGGAGG - Intergenic
1033023239 7:137748355-137748377 AAAAAAAAAAAGAATGGGGGCGG + Intronic
1033108197 7:138550004-138550026 GCTAAGATTAAGAATGGGGGAGG + Intronic
1034603200 7:152283160-152283182 AATAACCAAAAAAATGGGGGTGG - Intronic
1035654276 8:1293704-1293726 TGTATTATAAAGAATGGGGAAGG - Intergenic
1035856706 8:2983474-2983496 TACAACAGAAAGACTGGGCGAGG - Intronic
1036742615 8:11378179-11378201 TATAAAATAAAGAATACGGTTGG - Intergenic
1040641893 8:49344799-49344821 TATAAAAAAGAGAAAGGGGGTGG - Intergenic
1041627832 8:60051046-60051068 TATAAAATAAAGTCTGTGGGTGG - Intergenic
1042220606 8:66469577-66469599 TATAAAATAAAAAATGAGGCTGG - Intronic
1042654039 8:71075838-71075860 AATAACATAAAGTATGGTTGAGG - Intergenic
1043009051 8:74859199-74859221 TATATCATACACAATGGGGTAGG + Intergenic
1043583199 8:81737234-81737256 TATATCAGAATAAATGGGGGTGG - Intronic
1043769755 8:84183517-84183539 TATAAAATACAGTATGGCGGTGG - Intronic
1045149649 8:99389898-99389920 TAAAACATAAGGAGGGGGGGTGG - Intronic
1045345487 8:101289924-101289946 TGTAAGAGAAAGTATGGGGGAGG + Intergenic
1046437578 8:114212217-114212239 TAGCACAGAATGAATGGGGGTGG + Intergenic
1046517229 8:115278601-115278623 AATAACATAAAGTGTGGGAGAGG + Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1046800724 8:118423596-118423618 TATAAAAATAAGCATGGGGGTGG - Intronic
1047658973 8:127011718-127011740 AATCACATAGAGAAGGGGGGTGG + Intergenic
1048032633 8:130647184-130647206 TAGAAAATAACGAATGGGGCTGG + Intergenic
1048245751 8:132797007-132797029 GATAGAATAAAGAATGAGGGTGG - Intronic
1048714479 8:137252780-137252802 AATAACAGTATGAATGGGGGAGG + Intergenic
1050193512 9:3055490-3055512 AATAAGATAAAGAAGGGAGGCGG + Intergenic
1050218209 9:3353361-3353383 AATAAAATAAAGAAATGGGGAGG + Intronic
1051202311 9:14641047-14641069 TATAAAAGAAAGCATGTGGGTGG - Intronic
1052560331 9:30076914-30076936 TATAACTCAAAGCAGGGGGGCGG - Intergenic
1054822880 9:69541255-69541277 TATAGAAAACAGAATGGGGGGGG - Intronic
1055484022 9:76739428-76739450 GATAACAAAAAGAATGGGGTTGG + Intronic
1058029905 9:100183963-100183985 TACAGCATAAAGTATGGGGTGGG + Intronic
1186299271 X:8181549-8181571 TAGAACTTAAAGGATGAGGGTGG + Intergenic
1187452155 X:19408008-19408030 TATAACATAAAGAATGGTCTAGG - Intronic
1187806151 X:23123118-23123140 TAAAACATAAAGGATAGGGGAGG - Intergenic
1188343261 X:29031412-29031434 AATGACATAAAGAATGAGTGAGG + Intronic
1188475766 X:30590005-30590027 TATAACAGAAAGAATGAGCTTGG + Intergenic
1188907597 X:35806873-35806895 TATACCATACAGAAAGGGGTAGG - Intergenic
1189289514 X:39875432-39875454 CATAATATAAAGAATGGGGGTGG + Intergenic
1189804382 X:44720576-44720598 TAAAAAATTAAGAATGGGGCCGG - Intergenic
1189902774 X:45724497-45724519 TATAACCTACAGAATGGGAAAGG - Intergenic
1190556877 X:51644744-51644766 TATATCATAGAGATGGGGGGAGG + Intergenic
1190859579 X:54331045-54331067 TAAAAAATAAAAAATGGGGGTGG + Intronic
1190936752 X:55004732-55004754 TATAACAAAAAGACAGGGAGGGG - Intronic
1191594512 X:62927815-62927837 AATAAAATAAGGAATGTGGGAGG - Intergenic
1194763903 X:97826978-97827000 TATAACAAAAAGGATGGTGGAGG - Intergenic
1195239484 X:102937209-102937231 TAGAACATAAAAAATGGGATGGG - Intergenic
1195289439 X:103417588-103417610 TTTAACATATAAACTGGGGGTGG + Intergenic
1197297731 X:124739553-124739575 GATAACATAACCCATGGGGGTGG - Intronic
1197775057 X:130113375-130113397 TATAACACAAAGAAAGAGGCCGG - Intergenic
1198308446 X:135405507-135405529 TATAAAAGAGAGAATGGGGGAGG + Intergenic
1198485471 X:137083132-137083154 GTTAACAGAAAGAAAGGGGGGGG - Intergenic
1200099690 X:153684480-153684502 GAGAACAGAAAGAATGGGGCTGG - Intronic
1202202207 Y:22365458-22365480 TATAACATAAAGAGTGGGGGCGG + Intronic
1202274247 Y:23099138-23099160 AATAACATAAAGGCTGGTGGGGG + Intergenic
1202291779 Y:23321539-23321561 AATAACATAAAGGCTGGTGGGGG - Intergenic
1202427243 Y:24732883-24732905 AATAACATAAAGGCTGGTGGGGG + Intergenic
1202443548 Y:24937211-24937233 AATAACATAAAGGCTGGTGGGGG - Intergenic