ID: 916975783

View in Genome Browser
Species Human (GRCh38)
Location 1:170075893-170075915
Sequence AATAGGAAGTCCAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916975783 Original CRISPR AATAGGAAGTCCAATGAGGA AGG (reversed) Intronic
902057583 1:13615090-13615112 ATTAGGAGTTCCACTGAGGATGG + Intronic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
902694976 1:18134207-18134229 AATGGGAAGGCCACAGAGGAGGG - Intronic
904845620 1:33412084-33412106 ACTAGGAAGTGCAATAAGGCAGG + Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905454571 1:38079212-38079234 GAGAGAAAGTCCAGTGAGGAAGG - Intergenic
906172054 1:43734695-43734717 AATAGGAAGTTCAATAAAGTAGG - Intronic
906977314 1:50589336-50589358 AATACGAAGTCTGCTGAGGAGGG + Intronic
907296102 1:53455859-53455881 AACAGGAAGTCAAAAAAGGATGG - Intergenic
908029310 1:59982888-59982910 CATATGAAGTTCAAAGAGGAAGG + Intergenic
908585907 1:65568046-65568068 AATAGGAAGGCCACAAAGGATGG - Intronic
909556355 1:76958751-76958773 AACAGAGAGACCAATGAGGAAGG - Intronic
910675841 1:89815828-89815850 AACATCAAGTCCAAAGAGGAAGG - Intronic
910722950 1:90307505-90307527 ACTAGGAAGTCCAATATCGAGGG - Intergenic
912254507 1:108045334-108045356 AAGAGGAACTTCAATGAAGAAGG - Intergenic
914829013 1:151157146-151157168 AACAGGAAGGCCAAGGAGGAAGG + Intronic
916975783 1:170075893-170075915 AATAGGAAGTCCAATGAGGAAGG - Intronic
917771111 1:178279180-178279202 AACAGGAAGTCCAATATAGATGG - Intronic
917781955 1:178407227-178407249 ATTTGGAAGTCCAAACAGGAAGG - Intronic
920227660 1:204450026-204450048 GACAGGAAGTCAAATTAGGAGGG + Intronic
921066182 1:211623627-211623649 AATGGAAAGCCCCATGAGGACGG + Intergenic
922520544 1:226246987-226247009 AATAGGAAATACAGTGAGGAAGG - Intronic
922883106 1:228997509-228997531 AATACGAAGACCAGTTAGGAGGG - Intergenic
923717830 1:236440856-236440878 AATAGGAAGGCCCAAGAAGAGGG - Intronic
1063705289 10:8424566-8424588 AATAGGAAATGCAATGTGGGTGG + Intergenic
1064007216 10:11708197-11708219 AACAGGAAGGACATTGAGGAAGG + Intergenic
1065751426 10:28891082-28891104 AAGAGGAAGACCACAGAGGAAGG - Intergenic
1065799800 10:29341802-29341824 ACTGGGAAGTCCAAGGATGAGGG - Intergenic
1066032152 10:31439656-31439678 AATAGGGAGTGCAATGGGGGTGG + Intronic
1066547635 10:36518000-36518022 AACAGGAACTCCCATGAGAATGG + Intergenic
1067254260 10:44619900-44619922 AATATGTAATCTAATGAGGAAGG - Intergenic
1068617107 10:59130887-59130909 AATTGGAAGGCAAAGGAGGAAGG - Intergenic
1070853512 10:79586305-79586327 AATAGGCAGACCTCTGAGGAAGG + Intergenic
1071432913 10:85620127-85620149 GGTAGGAAGACCATTGAGGATGG - Intronic
1071727312 10:88212296-88212318 AGTAGGAAGTACCAAGAGGAGGG - Intergenic
1073186621 10:101618911-101618933 AAGAGGAAGCCCATGGAGGAAGG + Intronic
1073722341 10:106187162-106187184 AATTGGAAGTCAAAAGAAGAAGG - Intergenic
1074986841 10:118666731-118666753 AATAGGATGTGGCATGAGGAGGG - Intergenic
1075703412 10:124483886-124483908 TGTATGAAGTCCAGTGAGGATGG + Intronic
1075847755 10:125559171-125559193 AATAGGGAGGCCAAAGAAGAGGG - Intergenic
1076986844 11:243548-243570 AATAAGAAGACCACTGTGGAAGG - Intronic
1078761191 11:14253214-14253236 AATGGAAAGTCCATTCAGGAAGG + Intronic
1078914766 11:15769166-15769188 AATAGGAAATGCAAGGTGGATGG - Intergenic
1079187073 11:18247311-18247333 ACTAGGAAATCGAAGGAGGAAGG + Intronic
1079189731 11:18267566-18267588 ACTAGGAAATCGAAGGAGGAAGG - Intronic
1079441661 11:20520933-20520955 AGTAGAAAGACCAATTAGGAGGG - Intergenic
1079576165 11:22005461-22005483 AATAGGAAGTACAAAGGGAAGGG + Intergenic
1080940723 11:36914608-36914630 AATAAGAAGTCCAGTTAGGTCGG - Intergenic
1082108488 11:48245654-48245676 AATCAGCAGACCAATGAGGAAGG - Exonic
1082211674 11:49510677-49510699 AATAAGAAGTCCAAAGAGGAGGG + Intergenic
1083037859 11:59657079-59657101 AAAAGGAAGGCCAATTTGGAAGG - Intronic
1085922469 11:80974220-80974242 TATTGGATATCCAATGAGGAAGG + Intergenic
1086154243 11:83648236-83648258 GAGAGGAAGTACAAAGAGGATGG + Intronic
1086637969 11:89114399-89114421 AATAAGAAGTCCAAAGGGGAGGG - Intergenic
1089492571 11:118893104-118893126 AACAGGAAGACCCATGAGGAGGG + Intronic
1089522782 11:119076644-119076666 AATAGGAATTCTAAAGAGAACGG - Intronic
1090114308 11:123951350-123951372 AATATAAATGCCAATGAGGAGGG + Intergenic
1091021602 11:132104995-132105017 CATGGGAAGCCAAATGAGGAGGG + Intronic
1092140265 12:6178930-6178952 AATAGAAAGGCCAAGGAGAAAGG - Intergenic
1093208058 12:16274717-16274739 AAAGGGATGTCCAAAGAGGAGGG + Intronic
1095589513 12:43888242-43888264 TATATGAAGTACAATGTGGAGGG - Intronic
1095652660 12:44631049-44631071 GGTAGGAAATTCAATGAGGATGG - Intronic
1095815413 12:46416799-46416821 AATAAGAAGATGAATGAGGAAGG - Intergenic
1096661632 12:53128923-53128945 AAAAGGGTGTCCAAAGAGGAGGG - Intergenic
1096992004 12:55812282-55812304 AATAGGGAGTACAATGGGAAGGG - Intronic
1100774334 12:97957829-97957851 GTTAGGGAGTCCAATGAGGTGGG - Intergenic
1102422793 12:112817289-112817311 AATAGAAAGACCCATGGGGATGG - Intronic
1103211518 12:119170509-119170531 AGCAGGAAATCCAATGAGAAGGG + Intergenic
1103256033 12:119542282-119542304 AATAGGAATTCGAGTGAGGGAGG + Intergenic
1105461290 13:20590990-20591012 AATAGGAAGACCAATGACAGGGG + Exonic
1106794471 13:33190197-33190219 CTTTGGAAGGCCAATGAGGAAGG + Intronic
1109788648 13:67217667-67217689 AATAGTAATTCCTATGAGGATGG + Intronic
1110237222 13:73229508-73229530 AATAGAAAGTGGAATGAGAAGGG + Intergenic
1110504562 13:76270704-76270726 ACCAGGAGCTCCAATGAGGAAGG + Intergenic
1110777560 13:79426557-79426579 AAAAGGAAGAGCAATGAAGAAGG - Intergenic
1112532739 13:100220646-100220668 AATAGGAAGACCTATTAGAAAGG - Intronic
1113493596 13:110712246-110712268 AAGAGAAAGTCCAGTGAGAAAGG + Intronic
1113733265 13:112657586-112657608 GGAAGGAAGTCCCATGAGGAAGG - Intronic
1113733317 13:112657739-112657761 GGAAGGAAGTCCCATGAGGAAGG - Intronic
1113806900 13:113115315-113115337 AAGTGAAAGTCCAATGGGGATGG - Intronic
1114176818 14:20329347-20329369 AAGATGAAATCCACTGAGGAGGG - Exonic
1114549913 14:23526691-23526713 AGAAGAAAGTACAATGAGGAGGG + Intronic
1120145334 14:80972810-80972832 AATAGGTAGACCCATGTGGACGG - Intronic
1121070269 14:91013037-91013059 GATAGGGAGTCCTGTGAGGATGG - Intronic
1121797233 14:96745237-96745259 AATAGAACATTCAATGAGGATGG + Intergenic
1122123775 14:99568408-99568430 GAGAGGAAGGCCAAGGAGGAAGG - Intronic
1123682733 15:22774217-22774239 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1123762703 15:23444987-23445009 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1124142936 15:27093313-27093335 GATGGGAAAACCAATGAGGAGGG - Intronic
1124334484 15:28846740-28846762 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
1124962926 15:34411630-34411652 CATAGGAAGTCCTATGGTGATGG + Intronic
1124979549 15:34557856-34557878 CATAGGAAGTCCTATGGTGATGG + Intronic
1126156632 15:45571553-45571575 TATAGGAAGTCCAAAGACTAGGG + Intergenic
1127528505 15:59818027-59818049 AATGGGAAGGGCAATGAGGCAGG + Intergenic
1132303743 15:100793593-100793615 AATAGGAAGTAAACTGTGGAGGG + Intergenic
1134543589 16:15089910-15089932 AAAAGTAAGTCCACTGAGGCTGG + Intronic
1135361168 16:21816069-21816091 AAAAGTAAGTCCACTGAGGCTGG + Intergenic
1135567511 16:23523240-23523262 AATAGCAAGTGAAAGGAGGATGG - Exonic
1135728263 16:24873688-24873710 AATAGGAAAGCCAAGGAGAAGGG - Intronic
1136261362 16:29079328-29079350 AAAAGTAAGTCCACTGAGGCTGG - Intergenic
1136629463 16:31481053-31481075 AATGGGGAGGCCAAAGAGGAAGG + Intergenic
1136999596 16:35217166-35217188 AATGGGAGGGCCCATGAGGAAGG - Intergenic
1137764146 16:50964656-50964678 AACAGGCAGTCCAGTGGGGAAGG - Intergenic
1138486294 16:57346435-57346457 AATAAGAAGACCTAGGAGGAGGG + Intergenic
1140490285 16:75329602-75329624 ATTAGGAAAGCCAATGAGGCAGG - Intronic
1141303440 16:82839013-82839035 AATAGGTAAACCAATGAGCATGG + Intronic
1143073615 17:4319754-4319776 AACAGGAAGTCCAAATAAGATGG + Intronic
1145752269 17:27363673-27363695 AAAAGGAAGTCCTCTGAGTAGGG - Intergenic
1146422001 17:32695554-32695576 AGTAGGACTTCCAATGAGTAGGG + Intronic
1146605976 17:34257968-34257990 AATCTTCAGTCCAATGAGGAGGG + Intergenic
1146714526 17:35073538-35073560 CATATGAAGTCCTGTGAGGATGG - Intronic
1146714574 17:35074182-35074204 CATATGAAGTCCTGTGAGGATGG + Intronic
1149287605 17:55182462-55182484 AATATGAAGTACAATGAGAAGGG + Intergenic
1151464535 17:74276027-74276049 ACTAGGGAGTTCAATGTGGAGGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152291060 17:79440582-79440604 AAAATGAAGTCCAGTGGGGACGG - Intronic
1152988427 18:340454-340476 AATAAGCAGTTCAAAGAGGATGG + Intronic
1153910001 18:9698372-9698394 AATAGCAAGGCCAATGAGTGGGG - Intergenic
1155760171 18:29555175-29555197 AATTGGAAGTCCCATGATGATGG - Intergenic
1155804633 18:30152419-30152441 AATAGGAAGACAAATGACAATGG - Intergenic
1156957130 18:42980685-42980707 AACAGAAAACCCAATGAGGAAGG + Intronic
1158790376 18:60773527-60773549 AATAGGAAGTCCCAAGAAAAGGG + Intergenic
1167459601 19:49617742-49617764 ATTAGCGAGTCAAATGAGGAAGG + Intronic
1168104719 19:54159725-54159747 AATCGGAAGTGCAAAGAGGCGGG - Exonic
925869861 2:8260644-8260666 CATAGGAAGTTGAATGTGGAAGG - Intergenic
926009816 2:9399237-9399259 AAGAGGAAGACCAGGGAGGAAGG - Intronic
927343391 2:22008613-22008635 AAAAGGAGCTACAATGAGGAGGG - Intergenic
927408346 2:22797471-22797493 AGTAGGAAGGCCAAAGTGGAGGG - Intergenic
927459364 2:23284733-23284755 ACTTGGAAGGCCACTGAGGAAGG + Intergenic
929243630 2:39678006-39678028 GATAGGAAGCCCAAGAAGGAAGG + Intronic
929747923 2:44678277-44678299 AATAGGTAGTGAAATGGGGATGG + Intronic
935653573 2:105402625-105402647 AATAGTAAGTCAAAGGAGGATGG + Intronic
940497510 2:154452083-154452105 AATAAAAAGTCAAAAGAGGAAGG - Exonic
941047718 2:160695398-160695420 AATAGGAAGTACAGTGTGGCTGG + Intergenic
941838123 2:170048536-170048558 AAGAGCAAGTCCTTTGAGGAAGG - Intronic
942289574 2:174455555-174455577 AACAGGAAGTTCAGTTAGGAGGG + Intronic
943246993 2:185467368-185467390 AATAGGAAGGCCTGTGAAGAGGG + Intergenic
944428978 2:199613098-199613120 GCTAGGAAGTCCAAAGATGAGGG + Intergenic
944494365 2:200291406-200291428 AGTAGGAAGTTGAAAGAGGATGG - Intergenic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
947555433 2:231088686-231088708 AATAGGGAGTCCCAAGAAGAGGG - Intronic
948745596 2:240090806-240090828 AATAGGTACTCCAGTGAAGAGGG + Intergenic
1168930089 20:1614741-1614763 AATAGTAATGGCAATGAGGATGG + Intronic
1169411070 20:5370876-5370898 AATAGGAAGTGGAATGTGAAAGG - Intergenic
1170687675 20:18584277-18584299 GGTAGGAAGACCAGTGAGGAAGG + Intronic
1171774450 20:29352306-29352328 GCTAGGAAGTCCAAGGATGAAGG + Intergenic
1171816466 20:29789960-29789982 GCTAGGAAGTCCAAGGATGAGGG + Intergenic
1174848678 20:53969539-53969561 AATAGGCATTACAATAAGGATGG + Intronic
1175478493 20:59294183-59294205 GATTGGAAGTCCTTTGAGGATGG - Intergenic
1175744700 20:61447606-61447628 AAAAGGAAGTAGAATGAGCAGGG - Intronic
1175784778 20:61705597-61705619 CAGAGGAAGTCCCATGAGGGTGG - Intronic
1175919558 20:62444312-62444334 AAAAGGAAGAGCAATGAGGGAGG + Intergenic
1178606870 21:34045253-34045275 AATAGGAAGGCCAGTGTGGCTGG - Intergenic
1179044428 21:37831867-37831889 AAGAGGAAGGCAAATGAGAAGGG + Intronic
1180319925 22:11310552-11310574 GCTAGGAAGTCCAAGGATGAGGG + Intergenic
1180501775 22:15936260-15936282 AACAGGAAGACCTATGAGGCTGG - Intergenic
1181398643 22:22638229-22638251 AATAAAAAGTCCTATGGGGAAGG - Intergenic
1181712271 22:24697948-24697970 AAAAGGCAGTCACATGAGGAAGG - Intergenic
1182607256 22:31515677-31515699 AATAGGAATCACAATGAGGCTGG - Intronic
949305769 3:2638978-2639000 AAAAGGCAGACCAATGAGGAGGG - Intronic
949856951 3:8470544-8470566 AATAAGAAAGACAATGAGGATGG + Intergenic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
951851799 3:27149668-27149690 AATAGGAAGGCCTATGAAGAAGG - Intronic
954773572 3:52996673-52996695 AATAGGAAATTTAATAAGGATGG + Intronic
955164523 3:56497907-56497929 AATAGGGAGGCCAAAGAAGATGG + Intergenic
955791328 3:62591460-62591482 GATAGAAAGTCCCCTGAGGAGGG + Intronic
956051790 3:65255909-65255931 AAGAGAAAGTCCAATAAGGAGGG - Intergenic
956180525 3:66513882-66513904 AATAAGAAGTTTAGTGAGGAAGG - Intergenic
957180440 3:76870726-76870748 AAAAGGAACTCCAATCAGAAAGG - Intronic
959136648 3:102431159-102431181 AACAGAAAGACAAATGAGGAAGG + Intronic
959873752 3:111358778-111358800 AATAGGGAGGCCAGTGAGTATGG - Intronic
959988509 3:112603877-112603899 AATAGGAAGATCAATGAGTTCGG + Intergenic
962959381 3:140296174-140296196 AACAGAAAGAGCAATGAGGAAGG - Intronic
964180940 3:153884809-153884831 ACTAGGAAGTCCAAGGTTGAGGG - Intergenic
965259200 3:166458561-166458583 AAGAGGAGGGCCAGTGAGGAAGG - Intergenic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
969892166 4:10269940-10269962 AATAGGAAGTGCAAGGCTGAAGG + Intergenic
970454010 4:16203625-16203647 AATATGAAGACCGAAGAGGAAGG + Intronic
972950791 4:44319843-44319865 AATAAGACTTCCAATGAGAAAGG + Intronic
973077792 4:45951719-45951741 AATAGGAAGAACAATGAAAATGG + Intergenic
974755521 4:66202042-66202064 AATAGTAAATCCACTGAGGCTGG + Intergenic
975124911 4:70770949-70770971 AATAGGGAGGCCAAGGAGAAGGG + Intronic
975969644 4:80017675-80017697 AATAGGAAGAAGGATGAGGAAGG + Intronic
976456920 4:85258240-85258262 CAGAGGAAGTCCAAGGAAGAAGG + Intergenic
976951950 4:90844445-90844467 AATAAGAAGGCCAATGTGGCTGG - Intronic
977272987 4:94940998-94941020 ATTGGGAATTTCAATGAGGAAGG + Intronic
978610959 4:110538840-110538862 AATAGGGAGTCCCAAGGGGAAGG + Intronic
985866433 5:2517932-2517954 AAGAGAAAGTCCACTGTGGATGG - Intergenic
986219667 5:5756532-5756554 AATAGGAACAGCAAAGAGGATGG - Intergenic
986393339 5:7304753-7304775 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988529680 5:32016723-32016745 AAGTGGAAGTCCAAAGAGAAGGG - Intronic
990050394 5:51493033-51493055 AACAGGATCTCCAATGATGAAGG - Intergenic
991074023 5:62514900-62514922 AAGGGGAAGTGCAATGATGAAGG - Intronic
992095957 5:73362720-73362742 GGTAGGAAGACCAATTAGGAGGG - Intergenic
995442332 5:112205821-112205843 AATAAGAAAGCCAAGGAGGAAGG + Intronic
998678272 5:144434968-144434990 AAGAGGAAGGCGCATGAGGAAGG + Intronic
999689115 5:154130297-154130319 AAAAGGAAGAACAAAGAGGAAGG + Intronic
999840279 5:155417459-155417481 AATAGGAAGCTCCATGAGGGAGG - Intergenic
1000843086 5:166246167-166246189 AACTGGAAGTCCAATCAAGATGG - Intergenic
1002323845 5:178392598-178392620 CACAGGAAGTCCACTCAGGATGG + Intronic
1003477860 6:6501250-6501272 AATAGGAAGCCCAAGGATGGTGG + Intergenic
1004462911 6:15854999-15855021 AATAGTAACTGGAATGAGGAGGG - Intergenic
1004551126 6:16648178-16648200 AATAGTAGCTTCAATGAGGAAGG - Intronic
1005208873 6:23437116-23437138 AATAGGAAGACTATTGAGCATGG + Intergenic
1005236196 6:23764898-23764920 ATTATGAGGTCAAATGAGGAAGG + Intergenic
1006251467 6:32790624-32790646 AATAAGAAGGCCAGTGAGGCTGG + Intergenic
1007684274 6:43655975-43655997 GGAAGGAAGTCCAAGGAGGAAGG - Intronic
1013408342 6:109862118-109862140 AATAGGAGCTCCAAGGAGCATGG - Intergenic
1014305065 6:119729994-119730016 AAAAGGAAGGCTAATGAGGAAGG - Intergenic
1014537948 6:122638789-122638811 TATAGGAAGGACAATGATGATGG - Intronic
1015640729 6:135328598-135328620 AATAGGAAGCCCAAGGAGAAGGG - Intronic
1018709038 6:166484644-166484666 AAAAGGCAGTGCACTGAGGATGG + Intronic
1021179883 7:17494251-17494273 AATATGAAGTCTAATCAGAAGGG + Intergenic
1021652919 7:22848961-22848983 AATAAGCAGTTCATTGAGGAAGG + Intergenic
1022190566 7:28013379-28013401 AATAGGAGGGCCATTCAGGATGG + Intronic
1028773110 7:94649866-94649888 ACTAAGAAGTCCAATGAGAGAGG - Intronic
1028857525 7:95608526-95608548 AAAAGGAAGTACAAATAGGAAGG + Intergenic
1029159452 7:98541269-98541291 AATAGGGAGTCCACTGCGGGAGG + Intergenic
1029337709 7:99916417-99916439 GACAGGAAGTCCAAGGAAGAGGG - Intronic
1030022519 7:105289956-105289978 AGTAGGAAGGCCAAAGAGGAGGG + Intronic
1030319524 7:108150016-108150038 AATGGCCAGTTCAATGAGGATGG - Exonic
1030644532 7:112045128-112045150 AATAGCCAGTAGAATGAGGAAGG - Intronic
1033497617 7:141915681-141915703 ATGAGGAAGTCCGAGGAGGATGG - Intronic
1033529954 7:142251819-142251841 AAAAGGAAGTCTAATAAAGAGGG - Intergenic
1034035672 7:147818275-147818297 AATAGGAATTTCAAAGAGAAAGG - Intronic
1036374173 8:8186029-8186051 AATGGGAAATCTAAGGAGGATGG + Intergenic
1036655272 8:10673693-10673715 AAGAGCAAGTCCCAGGAGGAGGG + Intronic
1036876730 8:12479611-12479633 AATGGGAAATCTAAGGAGGATGG - Intergenic
1037245301 8:16827795-16827817 AAGATGGAGTCCAATGATGAGGG + Intergenic
1038063139 8:23934512-23934534 GACAGGAAGGCCCATGAGGAGGG + Intergenic
1038071342 8:24017564-24017586 ACTTGGAAGACCAAGGAGGATGG + Intergenic
1039889564 8:41674837-41674859 ACTAGGAAGAACAAGGAGGAAGG + Intronic
1041154280 8:54968668-54968690 ATTTGGAAGGCCAATGAGGGTGG + Intergenic
1042885402 8:73544298-73544320 AATAGAAAGACCAATTAGAATGG - Intronic
1043137568 8:76547638-76547660 AAGAGAAAGTCCAATAGGGAAGG - Intergenic
1043780385 8:84326919-84326941 AATAGGAAGTTCTATGAGGAAGG + Intronic
1045087849 8:98706586-98706608 AATAGGAACTCCATTTTGGATGG - Exonic
1049586249 8:143433750-143433772 AATAGTAAGTAAAATGAGGCCGG + Intergenic
1050136192 9:2467456-2467478 AATAGGAAGTCCTATGCAGTAGG - Intergenic
1052522623 9:29568234-29568256 AATAGAAAGTCCAAACAGCAGGG - Intergenic
1052892695 9:33719124-33719146 GATAGGAAGCCCACAGAGGAAGG - Intergenic
1053448680 9:38173791-38173813 AAGAGGAAATCTACTGAGGAAGG + Intergenic
1055033584 9:71794596-71794618 AATAGGCAGTGCTTTGAGGAGGG - Intronic
1056118310 9:83462506-83462528 CATAGTAATTCCACTGAGGATGG - Intronic
1057901457 9:98952039-98952061 CATAGGAAGTTCTATGAGGCAGG + Intronic
1058060047 9:100485542-100485564 AATAGGAACTTAAATGAAGATGG - Intronic
1060558333 9:124521789-124521811 AATAGGAAGTCAAATGTGTAAGG + Exonic
1061486117 9:130921262-130921284 GACAGGGAGTCTAATGAGGATGG + Intronic
1203368151 Un_KI270442v1:276309-276331 GCTAGGAAGTCCAAGGATGAGGG + Intergenic
1186676459 X:11822445-11822467 AAGAGGAAGTCTAAGGAGGCTGG + Intergenic
1188598258 X:31927983-31928005 AATAGGAAGAACAAAGTGGAAGG + Intronic
1188730248 X:33637199-33637221 AACAGGAAGACCAGTTAGGAGGG - Intergenic
1189835276 X:45014388-45014410 TACCGTAAGTCCAATGAGGATGG - Intronic
1192736399 X:73853202-73853224 AATGGGAAGTCCCTTGAAGATGG - Intergenic
1194431520 X:93812952-93812974 AATAGGAAGTGCCATGAGAAAGG + Intergenic
1195433335 X:104813956-104813978 ACTAGAAAGACCAAGGAGGAAGG - Intronic
1195966370 X:110433456-110433478 ACTAGGAAGGGTAATGAGGAAGG + Intronic