ID: 916983282

View in Genome Browser
Species Human (GRCh38)
Location 1:170163043-170163065
Sequence CAAGCTGACCACAGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916983278_916983282 -10 Left 916983278 1:170163030-170163052 CCGTGTGGAATGCCAAGCTGACC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG 0: 1
1: 0
2: 2
3: 19
4: 201
916983276_916983282 7 Left 916983276 1:170163013-170163035 CCAGCTGTCTTGTCACTCCGTGT 0: 1
1: 0
2: 0
3: 7
4: 94
Right 916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG 0: 1
1: 0
2: 2
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916983282 Original CRISPR CAAGCTGACCACAGGGATGC TGG Intronic
900458047 1:2786838-2786860 CAAGCTGAGCAAGAGGATGCAGG + Intronic
900726685 1:4220945-4220967 CAAAGTGGCCACATGGATGCAGG + Intergenic
901230487 1:7639319-7639341 CCAGCTGCCCACAGGTATTCTGG - Intronic
901395844 1:8981007-8981029 CAAGCTGCCCTCAAAGATGCTGG + Intergenic
902063785 1:13667023-13667045 CAAGCAAACCCCAGGGCTGCTGG - Intergenic
902320086 1:15656120-15656142 CAAGCTGAACACAGTGACTCTGG - Intronic
902641947 1:17772523-17772545 AAAGCTGACACCAGGGATGTTGG + Intronic
904284378 1:29444532-29444554 GAAGCTGAAGGCAGGGATGCAGG + Intergenic
906322734 1:44827064-44827086 GCAGCTGACCACAAGGAAGCTGG - Exonic
908046262 1:60172787-60172809 CCAGCTGACTCCAGGAATGCTGG - Intergenic
909146843 1:71945345-71945367 AAAGTTAACCACAGGGATGTAGG - Intronic
913283693 1:117209004-117209026 AAAGCTCATCTCAGGGATGCAGG - Intronic
916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG + Intronic
918047492 1:180950377-180950399 CAAGCTGTACTCAGGGCTGCTGG + Exonic
920179542 1:204123914-204123936 GAATCTGACGACAGGGGTGCAGG + Intronic
924282202 1:242449735-242449757 CAAGCTGACCCAGGGGAGGCAGG + Intronic
924641316 1:245836317-245836339 CGAGGGGAGCACAGGGATGCGGG - Intronic
924797664 1:247303983-247304005 CATGCAGTCCACAGGGTTGCAGG - Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064987510 10:21225870-21225892 CCAGCTGACCACAGTGGGGCAGG - Intergenic
1065660994 10:28004112-28004134 AAAGCTGACCACCAGGATTCCGG - Intergenic
1067152772 10:43750157-43750179 CCAGCTGATCACAGGGCTCCAGG + Intergenic
1067348440 10:45455162-45455184 CTACCTGGCCACAGGCATGCAGG - Exonic
1067409014 10:46048465-46048487 CCAGCTGCCCACAGGGAGGAAGG + Intergenic
1067658898 10:48218841-48218863 GAAGCTTGTCACAGGGATGCTGG + Intronic
1068106253 10:52620525-52620547 GAAGCTGCCCACTGGGGTGCTGG + Intergenic
1069160309 10:65084413-65084435 CAGGCTGGCCACAAGGCTGCAGG + Intergenic
1069695129 10:70380867-70380889 CAAGCTTCCCACTGGGAGGCAGG + Intronic
1072740030 10:97903692-97903714 GAAGCTGATCTCAGGGATCCAGG - Intronic
1075004055 10:118818013-118818035 CAAGCTGACTCCAGGGAGGACGG - Intergenic
1077413271 11:2413303-2413325 CAAAGTGCCCACTGGGATGCAGG + Intronic
1077488155 11:2848464-2848486 CACGCTGACTACAGGGCCGCCGG + Exonic
1078580407 11:12535324-12535346 AAAGCACACCAAAGGGATGCTGG - Intergenic
1078897953 11:15614866-15614888 TCAGATGCCCACAGGGATGCAGG + Intergenic
1079963652 11:26954015-26954037 CAAGCTGTTCACTGTGATGCAGG + Intergenic
1081440047 11:43070569-43070591 CTAACTGAGCACAAGGATGCGGG - Intergenic
1082633869 11:55572846-55572868 CAAGATGACCACAATGATGTGGG - Exonic
1082679641 11:56152450-56152472 CAAGATGGCCACTGGGATGGCGG - Intergenic
1082959205 11:58902803-58902825 CACTCTGTCCTCAGGGATGCTGG + Intronic
1083214544 11:61210225-61210247 CCAGCTCTCCCCAGGGATGCTGG - Intronic
1083217428 11:61229054-61229076 CCAGCTCTCCCCAGGGATGCTGG - Intronic
1083220420 11:61248804-61248826 CCAGCTCTCCCCAGGGATGCTGG - Intronic
1084569403 11:69950437-69950459 CCAGCTGAGCACAAGGTTGCAGG - Intergenic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1086010047 11:82091296-82091318 CAGGCAGATCACAGAGATGCAGG + Intergenic
1088721485 11:112596041-112596063 TATGGTGACCTCAGGGATGCTGG + Intergenic
1089017393 11:115177674-115177696 CAAGCTTACCACCGAGAGGCTGG + Intronic
1090976463 11:131684267-131684289 CAACCTGACCACAGCGATCCAGG + Intronic
1091394811 12:147552-147574 CAACCGGACCACAGGGGTCCTGG - Intronic
1091618408 12:2067191-2067213 CAAGGTGGCCAGTGGGATGCAGG + Intronic
1092056293 12:5510818-5510840 CAAGCTGAGCCCAGGGTTACAGG - Intronic
1093058320 12:14577372-14577394 CAAGCTGCCCCCAAGGTTGCAGG - Intergenic
1095659759 12:44717862-44717884 CAAGGAGACCAGAGTGATGCAGG + Intronic
1095989212 12:48022854-48022876 CAAGATGGCCTCAGGGATTCTGG - Intronic
1101848712 12:108385310-108385332 CACCCTGACCAGAGGAATGCAGG - Intergenic
1102755755 12:115338646-115338668 CATGATTACCACAGGAATGCTGG - Intergenic
1104648603 12:130514643-130514665 CAGGCTGACGACAGGGCTGGTGG - Intronic
1104876583 12:132039104-132039126 CAAGCTGAGCACAGGCAAGGAGG - Intronic
1108255245 13:48603437-48603459 CATGCTAACCACTGGGCTGCAGG - Intergenic
1108934790 13:55870750-55870772 CAAAGGGACCACAGTGATGCTGG + Intergenic
1110142299 13:72145430-72145452 CAAGCAGAGGACAGGGATCCAGG + Intergenic
1114930903 14:27466301-27466323 CAGGCTGACCGCAGAGATCCTGG + Intergenic
1117726483 14:58679765-58679787 CAAGCCGACCCCAGGAAGGCTGG - Intergenic
1118149836 14:63178014-63178036 CAAGCTAACTACAGGAATCCAGG - Intergenic
1122717959 14:103706713-103706735 CTGGCTGAGCACAGCGATGCCGG - Intronic
1122767740 14:104083402-104083424 CATGGTGCTCACAGGGATGCAGG + Intergenic
1125589334 15:40844598-40844620 CAAGGCGACGGCAGGGATGCCGG - Exonic
1125728457 15:41880097-41880119 GCAGCAGACCACAGGGAGGCAGG + Intronic
1127568300 15:60215094-60215116 CAAGCTGACCACATGGGAGGGGG - Intergenic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129375227 15:75126127-75126149 TAAGCTGAGCTCAGGGTTGCAGG + Intergenic
1130236010 15:82134149-82134171 CAGGCTGTCCACACAGATGCAGG - Intronic
1133311572 16:4850417-4850439 CAAGTTAACCAATGGGATGCAGG - Intronic
1137262607 16:46843820-46843842 CAACCTGGGCACAGGGCTGCAGG - Intergenic
1137435058 16:48448136-48448158 CAAGCTGAACACAGGGAGGTGGG - Intronic
1137604820 16:49780392-49780414 CAGGCGGAGCACAGGGGTGCTGG + Intronic
1138609472 16:58111220-58111242 CATGCTAAGCACAGGGAAGCAGG + Intergenic
1139591580 16:67936051-67936073 CGAGATGACCACACGGATGGTGG - Exonic
1140970624 16:80009054-80009076 TAAGCTGACAACATGAATGCGGG + Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141728505 16:85806781-85806803 CAAGCAGACCAAGAGGATGCTGG + Exonic
1141923288 16:87150710-87150732 CAATCTTACCACAGGGATGGGGG + Intronic
1143275341 17:5705871-5705893 CAAACTGACCACAGGAATCCTGG - Intergenic
1143282097 17:5762564-5762586 GGAGCTGACCCCAGGGCTGCTGG - Intergenic
1149609244 17:57947974-57947996 AAAGCTGCCCACAAGTATGCTGG - Intronic
1150575786 17:66429949-66429971 CACACAGACCACAGAGATGCTGG - Intronic
1151175570 17:72285064-72285086 GAAGGTGACCACAGTGATGAGGG + Intergenic
1151334285 17:73430935-73430957 CAAGTGGCCCACAGGTATGCTGG + Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151568978 17:74916547-74916569 CAAGCTGAGGTCAGGGATGGGGG + Exonic
1152121252 17:78420034-78420056 CAAGCTGAGCACACTGGTGCAGG + Intronic
1154256132 18:12782250-12782272 CAAGCTGAGAACAGGGAAGCTGG - Intergenic
1155032191 18:21994361-21994383 CATGGAGACCACAAGGATGCTGG + Intergenic
1155802887 18:30131282-30131304 CAAGCTGAGCACAGGGTGCCCGG + Intergenic
1157410205 18:47457266-47457288 CAAGCAGAAAACAGGGCTGCAGG - Intergenic
1161510693 19:4669676-4669698 CAAGCTGAGTACAGGGCTGAGGG + Intronic
1163081007 19:14942213-14942235 CAAGCTGACCACTGAGAGGTGGG - Exonic
1163331042 19:16637959-16637981 TAAGCTGACAAAAGGGAGGCTGG + Intronic
1165259917 19:34604314-34604336 CATAGTGACCACAGGGATGTGGG - Intronic
1165455480 19:35908118-35908140 CAAGCTGAGCCCAGGGACCCGGG + Intronic
1166716629 19:44972780-44972802 CCTGGTGACCACAGGGCTGCAGG - Intronic
1166748954 19:45155679-45155701 CAGGCTGGCCACAGGGGTGGGGG + Intronic
1167260387 19:48454662-48454684 CAAGCTGAGGACAGGGATGCTGG - Exonic
1167467715 19:49658860-49658882 CGAGCTGCTCACAGGGAGGCAGG + Intergenic
1167892619 19:52553337-52553359 CAACATGATCACAGGCATGCTGG + Exonic
1167911484 19:52706612-52706634 CAACATGATCACAGGCATGCTGG - Exonic
1167919084 19:52767520-52767542 CAACATGATCACAGGCATGCTGG - Exonic
1167993449 19:53380952-53380974 CAATATGATCACAGGCATGCTGG + Exonic
1168189295 19:54726308-54726330 CATGATCACCACAGGGTTGCTGG - Exonic
925693680 2:6551738-6551760 CAAGGTGACCACAGGCATCCTGG - Intergenic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
926251950 2:11159746-11159768 CCAGGAGACCACAGGGATTCCGG + Intronic
927062705 2:19439536-19439558 CAAGATGACCACAGTGATCTAGG - Intergenic
932430823 2:71672714-71672736 CAAGCTGGCCAGAGGAATGGAGG + Intronic
932566694 2:72915611-72915633 CAAGGTTCCCACAGGGATGCGGG - Intergenic
932750139 2:74366279-74366301 CAAGCTGGCCACAGCCATGCAGG - Exonic
933559603 2:83874301-83874323 CAAGATGGCCACTGGGATGGTGG + Intergenic
933560467 2:83879387-83879409 CAAGATGGCCACTGGGATGGCGG + Intergenic
933561403 2:83890618-83890640 CAAGCTGTCCACTGGGCTCCAGG + Intergenic
934935125 2:98459841-98459863 CAACTTGACCTCAGGGAAGCAGG - Intronic
938735756 2:134185240-134185262 CTCGATGACCACAGGGCTGCAGG - Intronic
938932690 2:136100584-136100606 CACGCTGAACACAGGGATGAAGG + Intergenic
940435735 2:153651643-153651665 GAAGCTGACCATAGGGCTGGTGG + Intergenic
941333522 2:164210465-164210487 CAAGGTGTCCACAGGGCTGGGGG - Intergenic
944103984 2:196059664-196059686 AAAGCTGCCCACAGGGATGCTGG - Intronic
946588574 2:221218081-221218103 CATGATGACCACAGGGACGAAGG + Intergenic
947836610 2:233180434-233180456 CAGGCTGAGCACAGGGGTACAGG - Intronic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
948387276 2:237588860-237588882 CACCATGACCACTGGGATGCCGG + Intronic
948887519 2:240891594-240891616 CAAGCTGCCCTCAGGGAATCCGG + Exonic
948967585 2:241395534-241395556 CCAGGTGACCACAGGGATCTGGG - Intronic
1168840343 20:906044-906066 CAGGATGACCCCAGGGATCCTGG + Intronic
1169090746 20:2860126-2860148 CAGGCTGGCCAGAGGCATGCCGG - Exonic
1170297443 20:14843926-14843948 CCAGATGACCACAGGGGTGTAGG - Intronic
1170958647 20:21004516-21004538 CAAGCTGATCAAAAGAATGCAGG + Intergenic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172277426 20:33687204-33687226 CCAGCTGATTACAGGGATTCCGG - Intergenic
1172647345 20:36479208-36479230 CAAGCAGATGACAGTGATGCTGG - Intronic
1173039983 20:39453037-39453059 GAAGCTGGCCACAGGGAAGCTGG + Intergenic
1173121353 20:40292719-40292741 CAAGAAGAACACATGGATGCAGG + Intergenic
1173225838 20:41161990-41162012 CCTGCTGCCCACTGGGATGCTGG - Intronic
1175710932 20:61220351-61220373 CAACCTGACCACGTGGATGCAGG - Intergenic
1175746361 20:61459934-61459956 CAAGCTGACCCCAGGGCCGCAGG + Intronic
1176925923 21:14748653-14748675 CAAGATGACCACTATGATGCTGG - Intergenic
1177538884 21:22465628-22465650 CCAGCTGGCCTCAGGCATGCAGG + Intergenic
1177867596 21:26531223-26531245 CATGCTCACCACAGGGAAGCTGG + Intronic
1178767846 21:35471164-35471186 CAATCTGACCCAAGTGATGCTGG + Intronic
1178819758 21:35964275-35964297 CAAGCTGCCAACATAGATGCTGG - Intronic
1182691128 22:32164230-32164252 CACCCTGAGCACAGAGATGCAGG + Intergenic
1183437898 22:37805787-37805809 CAAGCAGACCAAAGGGGTGGGGG + Exonic
1183741990 22:39673976-39673998 GAAGATGGCCACAGGAATGCGGG + Exonic
1183804026 22:40193048-40193070 CAAGCTGACCGCTGGGGCGCCGG - Intronic
1184441353 22:44518496-44518518 CCAGCTAACCACAGGCATGTGGG - Intergenic
1184761588 22:46547721-46547743 CCAGCTGGCCTCGGGGATGCAGG + Intergenic
1185342580 22:50298258-50298280 CAAGGGCAGCACAGGGATGCTGG + Intronic
949262246 3:2116320-2116342 CAAGCTGAGGACAGGAATGATGG - Intronic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
953549061 3:43886452-43886474 CTAGCTGACCTCAGAGTTGCAGG - Intergenic
953889732 3:46743044-46743066 CATGCTGACCCCAGAGCTGCAGG - Exonic
957174170 3:76784279-76784301 CAACCTGACTAGAGGGATTCTGG + Intronic
958932370 3:100221351-100221373 CAGGCTAACCACAGGGAGTCAGG - Intergenic
962013596 3:131418521-131418543 CAAGGTGAGCACAGGATTGCTGG - Intergenic
965616074 3:170593830-170593852 CAAGCTGACCACAGAGCTAGGGG - Intronic
966850754 3:184163753-184163775 CCAGCCCAGCACAGGGATGCAGG - Intronic
968652407 4:1765470-1765492 CCAGCAGACCCCAGGGATGCAGG - Intergenic
969177888 4:5413060-5413082 CAAGCTGTCAACAGGGTTTCTGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
981263199 4:142747817-142747839 CAATAAGAACACAGGGATGCAGG + Intronic
982345038 4:154348080-154348102 CAAGTTGGCAACAGGGATGTGGG + Intronic
983429709 4:167633079-167633101 CAATGAGAACACAGGGATGCAGG + Intergenic
983528141 4:168781616-168781638 TCAGCAGACCACAGTGATGCAGG + Intronic
985581473 5:697619-697641 CAAGCAGACCACAAGGAGCCTGG + Intergenic
985596100 5:788950-788972 CAAGCAGACCACAAGGAGCCTGG + Intergenic
986028999 5:3877978-3878000 AAAACTGTCCACTGGGATGCTGG - Intergenic
986738011 5:10682017-10682039 CATGCTTCCTACAGGGATGCTGG - Intronic
991697783 5:69289077-69289099 CAAGCTCCACACAGGGTTGCAGG + Intronic
992143083 5:73819062-73819084 CAAGCTCACCACAGGCTTACAGG - Intronic
997392877 5:133531339-133531361 CAAGGTGACCACAGAGATTAGGG - Intronic
998537549 5:142948547-142948569 CAGCATGGCCACAGGGATGCTGG - Intronic
999768350 5:154756675-154756697 CATGCTGGCCGCACGGATGCGGG + Intronic
1008349723 6:50475789-50475811 CAAGCATACCACAGGAAGGCAGG + Intergenic
1011623954 6:89268496-89268518 CAAGCAGACCAGGGGGATGTGGG + Intronic
1012620576 6:101339546-101339568 CAAGCTGACTTAAGGGATGTTGG - Intergenic
1013614308 6:111827570-111827592 AAAGCTGACCACAGTGACACTGG + Intronic
1015591515 6:134827240-134827262 CAGGCTGACCGCAGGGAGGTGGG + Intergenic
1016899656 6:149089018-149089040 GAAGCTGACCAGGGGGATTCTGG - Intergenic
1019131842 6:169882692-169882714 CAAGGTGTCCACAGGCATGGAGG - Intergenic
1019250008 6:170737510-170737532 CCAGCTGACCGCAGACATGCAGG - Intergenic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1021508687 7:21411948-21411970 CAAGAAGCCCACAGGGAAGCTGG - Intergenic
1023000838 7:35806006-35806028 CACGATGACAGCAGGGATGCTGG - Intronic
1023392798 7:39726567-39726589 CAGGCTGCCCTCAGGGTTGCAGG + Intergenic
1023406616 7:39840498-39840520 CAAGCTGCTCACACTGATGCTGG + Intergenic
1024571567 7:50727173-50727195 CAAGCTGACCACTCAGAGGCTGG - Intronic
1026569762 7:71519194-71519216 CCAGATAAACACAGGGATGCAGG + Intronic
1032188350 7:129747084-129747106 CAGGCAGAGCACAGGGCTGCAGG - Intronic
1035679496 8:1477544-1477566 GAAGATGACCACCGGGCTGCCGG - Intergenic
1035941879 8:3910329-3910351 CAAACTGACGACAGGGTGGCAGG + Intronic
1036518068 8:9463965-9463987 CCACATAACCACAGGGATGCTGG - Intergenic
1037584794 8:20268995-20269017 CAAGCTGCCCACCGGGATGGAGG - Intronic
1038819599 8:30940171-30940193 GAAACTTACCACAGGGATGTTGG + Intergenic
1040296362 8:46151120-46151142 TAGGCAGACCACAGGGATTCAGG - Intergenic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1040601635 8:48890475-48890497 CACGCTGGGCGCAGGGATGCGGG + Intergenic
1042710185 8:71708546-71708568 TCAGCAGACCACAGGGTTGCAGG + Intergenic
1047927468 8:129695594-129695616 CATGCTGACCACAGGGAGGTGGG - Intergenic
1049757379 8:144316739-144316761 CATGGTGACCACAGGGCTGGGGG + Intronic
1050251816 9:3752826-3752848 CAGACTGACAACAGGGATGCTGG - Intergenic
1051806189 9:20995291-20995313 AAAGCTGACTTCTGGGATGCTGG - Intronic
1057119823 9:92561193-92561215 CAAGGTGACCAAATGGAAGCTGG - Intronic
1057305691 9:93910821-93910843 CAGGCTGGCCACAGGGTGGCAGG + Intergenic
1058468664 9:105254474-105254496 CAAGGTGGCGGCAGGGATGCAGG + Intronic
1058828592 9:108796065-108796087 CAGACTGTCCCCAGGGATGCTGG + Intergenic
1060525093 9:124315918-124315940 CATGATGACAACAGGGACGCTGG + Intronic
1187844097 X:23518850-23518872 GGTGGTGACCACAGGGATGCTGG - Intergenic
1188246424 X:27840790-27840812 GAGGCTGACCCCAGGGGTGCAGG - Intergenic
1188878808 X:35466788-35466810 CAAACTGACCAGGGAGATGCAGG + Intergenic
1195802196 X:108725403-108725425 CCAGTTGATCACAGGGGTGCAGG - Intronic
1196610512 X:117708993-117709015 GAAGCTGACATCATGGATGCTGG + Intergenic
1199505198 X:148553633-148553655 CCTTCTGACCACAGGGATTCAGG - Intronic
1199783283 X:151082528-151082550 TAGGCTGACCACAGGGTGGCGGG - Intergenic
1200954926 Y:8934514-8934536 CAGGCTGCCAACAGGGATGAAGG - Intergenic
1201624946 Y:16004548-16004570 AGAGCTGAACACAGGGAGGCTGG + Intergenic