ID: 916985966

View in Genome Browser
Species Human (GRCh38)
Location 1:170191692-170191714
Sequence TCCCCAGGCACTCTATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916985953_916985966 29 Left 916985953 1:170191640-170191662 CCACAGGCTGGAATGGCTGTCAT No data
Right 916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG No data
916985958_916985966 -2 Left 916985958 1:170191671-170191693 CCCAGGTGGCAGCCTTCCCCATC No data
Right 916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG No data
916985952_916985966 30 Left 916985952 1:170191639-170191661 CCCACAGGCTGGAATGGCTGTCA No data
Right 916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG No data
916985956_916985966 6 Left 916985956 1:170191663-170191685 CCAACCAACCCAGGTGGCAGCCT No data
Right 916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG No data
916985957_916985966 2 Left 916985957 1:170191667-170191689 CCAACCCAGGTGGCAGCCTTCCC No data
Right 916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG No data
916985959_916985966 -3 Left 916985959 1:170191672-170191694 CCAGGTGGCAGCCTTCCCCATCC No data
Right 916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916985966 Original CRISPR TCCCCAGGCACTCTATCCCA GGG Intergenic
No off target data available for this crispr