ID: 916986075

View in Genome Browser
Species Human (GRCh38)
Location 1:170192299-170192321
Sequence CATGCTTCTCCCATTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916986075_916986080 17 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986080 1:170192339-170192361 AGTCACTCACCACTCCCTTTGGG No data
916986075_916986085 28 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986085 1:170192350-170192372 ACTCCCTTTGGGTGTGGTTGGGG No data
916986075_916986083 26 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986083 1:170192348-170192370 CCACTCCCTTTGGGTGTGGTTGG No data
916986075_916986086 29 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986086 1:170192351-170192373 CTCCCTTTGGGTGTGGTTGGGGG No data
916986075_916986084 27 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986084 1:170192349-170192371 CACTCCCTTTGGGTGTGGTTGGG No data
916986075_916986079 16 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986079 1:170192338-170192360 CAGTCACTCACCACTCCCTTTGG No data
916986075_916986081 22 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986081 1:170192344-170192366 CTCACCACTCCCTTTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916986075 Original CRISPR CATGCTTCTCCCATTGATCT TGG (reversed) Intergenic
No off target data available for this crispr